Gene detail

Detail information of GWHGAAZE003912

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008240601.1	5.92329E-78	PREDICTED: protein PHR1-LIKE 1-like isoform X2 [Prunus mume]
Swissprot	tr\|Q8GUN5\|PHL1_ARATH	2E-35	Protein PHR1-LIKE 1
trEMBL	tr\|M5VRH6\|M5VRH6_PRUPE	2E-76	Uncharacterized protein {ECO:0000313\|EMBL:EMJ03601.1}
TAIR10	AT2G01060.1	1E-33	myb-like HTH transcriptional regulator family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	106934318	106936883	+
GWHAAZE00000001	mRNA	106934318	106936883	+
GWHAAZE00000001	exon	106934318	106934428	+
GWHAAZE00000001	exon	106934747	106934795	+
GWHAAZE00000001	exon	106934897	106934954	+
GWHAAZE00000001	exon	106935331	106935400	+
GWHAAZE00000001	exon	106936461	106936883	+
GWHAAZE00000001	CDS	106934318	106934428	+
GWHAAZE00000001	CDS	106934747	106934795	+
GWHAAZE00000001	CDS	106934897	106934954	+
GWHAAZE00000001	CDS	106935331	106935400	+
GWHAAZE00000001	CDS	106936461	106936787	+
GWHAAZE00000001	three_prime_UTR	106936788	106936883	+

Transcript Sequence
>GWHTAAZE003918 ATGCTTGTTCTTAGTATTTGTGGTTTTGATTCAGGGGCAACTCCTAAAGGTGTCTTAAGAGTGATGGGCGTACCTGGACTTACTATTTATCATGTGAAAAGCCACCTACAGAAGTATCGCCTTGCAAAGTACCTACCAGATTCACCAGCTGATGGTAAAGGTTCCAAAGATGACAAGAAAGGTTCTGGAGACAGCCTTGATAGCATGGATTCTCCGCCGGGAGTGCAAATTAATGAGGCCCTGAGGATGCAAATGGAAGTTCAGAAGCGTCTTCATGAACAACTTGAGGTGCAAAGACAGTTACAAATGAGAATCGAAGCACAGGGAAAATACTTGCAGAAGATCATTGAAGAACAACAACAACTAGGCAGTTCTCTCAAAGCGTCTGAGACTGACGATGATAATAAGCAAGAGCAGCAGCGAGCTTCTGATGCCGCTGCCTCGGCCGGTTCCTCCTCTCCTCGAAAGAAGCAAAAGGTGATTAATGATGGATTATTTACAGAGGGCAATTCTTCAACTGACCCGTCCAAACACGGCCTTGTCAATCAGTGGGACCGCAACTTGTACGGCACTAGTAAAGTTGGTTCGGCGAACCAGGCCGGCCCGATGGGTTGAGATCTAAAATGCCCAAGTGTGGTTCGGATTAAAGGTTATTTCTGTAGTTGCAGTTGTACATCTGTGTTTGTATAGATGATATTTATATATAATAGC

Network for GWHGAAZE003912

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF14379.7	Myb_CC_LHEQLE	75	121	2.80E-24

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GARP-G2-like

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.503
	SRR3591706	second leaf	21.713
	SRR3591707	mature leaf	39.373
	SRR3591708	Shoot apex	23.540
	SRR3591709	Stem	38.796
	SRR3591710	White floral bud	30.515
	SRR3591711	White flower	42.167
	SRR3591712	Green floral bud	25.164
	SRR3591713	Yellow flower	42.564
SRP173429	SRR8316895	Juvenile bud stage	14.711
	SRR8316896	Juvenile bud stage	18.388
	SRR8316897	Juvenile bud stage	8.469
	SRR8316894	Third green stage	7.313
	SRR8316900	Third green stage	24.309
	SRR8316901	Third green stage	23.061
	SRR8316898	Complete white stage	18.485
	SRR8316899	Complete white stage	50.213
	SRR8316903	Complete white stage	24.083
	SRR8316902	Silver flowering stage	20.571
	SRR8316904	Silver flowering stage	22.082
	SRR8316905	Silver flowering stage	10.868
	SRR8316906	Gold flowering stage	41.295
	SRR8316907	Gold flowering stage	34.900
	SRR8316908	Gold flowering stage	41.276
SRP132670	SRR6706286	Control	23.444
	SRR6706287	Light intensity 50%	23.193
	SRR6706288	Light intensity 20%	23.789
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.145
	CNS0095593	Slightly white alabastrum(diploid) 2	24.166
	CNS0095594	Slightly white alabastrum(diploid) 3	22.571
	CNS0095595	Whole white alabastrum(diploid) 2	23.007
	CNS0095596	Whole white alabastrum(diploid) 3	14.097
	CNS0095597	Whole white alabastrum(diploid) 4	23.046
	CNS0095598	Silvery flower (diploied) 1	46.743
	CNS0095599	Silvery flower (diploied) 2	37.770
	CNS0095600	Silvery flower (diploied) 3	30.542
	CNS0095601	Golden flower (diploid) 1	38.518
	CNS0095602	Golden flower (diploid) 2	36.480
	CNS0095603	Golden flower (diploid) 3	37.379
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.368
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.426
	CNS0095606	Slightly white alabastrum(tetraploid) 3	28.908
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.769
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.824
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.644
	CNS0095610	Silvery flower (tetraploid) 1	36.478
	CNS0095611	Silvery flower (tetraploid) 2	38.381
	CNS0095612	Silvery flower (tetraploid) 3	38.276
	CNS0095613	Golden flower (tetraploid) 1	36.901
	CNS0095614	Golden flower (tetraploid) 2	37.337
	CNS0095615	Golden flower (tetraploid) 3	44.295
CRA001975	CRR073297	Stem 1	22.040
	CRR073298	Stem 2	25.948
	CRR073299	Stem 3	21.375
	CRR073300	Leaf 1	26.384
	CRR073301	Leaf 2	28.322
	CRR073302	Leaf 3	21.850
	CRR073303	Juvenile bud 1	21.034
	CRR073304	Juvenile bud 2	22.180
	CRR073305	Juvenile bud 3	25.138
	CRR073306	Third green 1	19.988
	CRR073307	Third green 2	18.719
	CRR073308	Third green 3	18.333
	CRR073309	Second white 1	11.797
	CRR073310	Second white 2	19.008
	CRR073311	Second white 3	11.897
	CRR073312	Silver flowering 1	11.625
	CRR073313	Silver flowering 2	9.891
	CRR073314	Silver flowering 3	10.618
	CRR073315	Gold flowering 1	38.626
	CRR073316	Gold flowering 2	45.389
	CRR073317	Gold flowering 3	29.253
	CRR073318	Tawny withering 1	28.874
	CRR073319	Tawny withering 2	32.954
	CRR073320	Tawny withering 3	29.743