Gene detail

Detail information of GWHGAAZE003846

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006430046.1	1.08083E-74	hypothetical protein CICLE_v10012232mg [Citrus clementina]
Swissprot	tr\|Q8LFU0\|NFYAA_ARATH	2E-45	Nuclear transcription factor Y subunit A-10
trEMBL	tr\|V4T1B6\|V4T1B6_9ROSI	4E-75	Uncharacterized protein {ECO:0000313\|EMBL:ESR43286.1}
TAIR10	AT5G06510.2	3E-31	nuclear factor Y, subunit A10

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	105653518	105654410	+
GWHAAZE00000001	mRNA	105653518	105654410	+
GWHAAZE00000001	exon	105653518	105653658	+
GWHAAZE00000001	exon	105654006	105654410	+
GWHAAZE00000001	CDS	105653518	105653658	+
GWHAAZE00000001	CDS	105654006	105654410	+

Transcript Sequence
>GWHTAAZE003852 GGACGCATAATGCTACCATTGAGCTTGACCACTGACGACGGACCAATTTATGTCAATGCTAAGCAATACCACGGAATAATAAGGCGCCGACAGTCTCGTGCTAAAGCCGAATTGGAGAATAAAGCGCAAAGGAATCGTAAGCCATATTTGCACTTGTCTCGCCACCTCCATGCAATGCGCCGACCAAGGGGCTGCGGTGGGCGCTTCCTCAACACAAAAAAATCAGACGGTAGCAAAAAGACTGGCGGAGGACAACACCACTCTCATCCGACTGCGTCTCAGAGTTCTGAAGTTCTTCAGTCCGATAGCGATAACTTGACCTCGCCAAGGGACAGAAATGGCAACAACCGATCAAACCTGTCAGGATCCGAAGTGACCAGCATGTTCTCCATGGCAGATCTCAATCGATTCCCGTTCAATAATCTCCAGCCGTCGATTCTCTCCTTCTCCGAAATTATGAATGCTGGACATGGCAGCATGGTTATGCCCAGTAAATGGATTGCAGCAGCTATTCCGTCGGATAGCTGCTGCAACCTCAAAGTTTAA

Network for GWHGAAZE003846

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02045.16	CBFB_NFYA	15	69	3.30E-26

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YA

KEGG pathway

KO	Enzyme	pathway	mapID
K08064	NFYA, HAP2	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0016602	cellular_component	CCAAT-binding factor complex
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.030
	SRR3591706	second leaf	6.021
	SRR3591707	mature leaf	10.851
	SRR3591708	Shoot apex	3.116
	SRR3591709	Stem	10.377
	SRR3591710	White floral bud	5.452
	SRR3591711	White flower	7.520
	SRR3591712	Green floral bud	1.992
	SRR3591713	Yellow flower	7.491
SRP173429	SRR8316895	Juvenile bud stage	7.474
	SRR8316896	Juvenile bud stage	9.710
	SRR8316897	Juvenile bud stage	2.850
	SRR8316894	Third green stage	2.680
	SRR8316900	Third green stage	8.380
	SRR8316901	Third green stage	11.836
	SRR8316898	Complete white stage	7.402
	SRR8316899	Complete white stage	35.516
	SRR8316903	Complete white stage	11.857
	SRR8316902	Silver flowering stage	4.637
	SRR8316904	Silver flowering stage	7.212
	SRR8316905	Silver flowering stage	3.684
	SRR8316906	Gold flowering stage	23.070
	SRR8316907	Gold flowering stage	10.751
	SRR8316908	Gold flowering stage	7.045
SRP132670	SRR6706286	Control	8.299
	SRR6706287	Light intensity 50%	10.304
	SRR6706288	Light intensity 20%	13.658
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.047
	CNS0095593	Slightly white alabastrum(diploid) 2	3.384
	CNS0095594	Slightly white alabastrum(diploid) 3	3.212
	CNS0095595	Whole white alabastrum(diploid) 2	1.329
	CNS0095596	Whole white alabastrum(diploid) 3	1.113
	CNS0095597	Whole white alabastrum(diploid) 4	2.895
	CNS0095598	Silvery flower (diploied) 1	6.490
	CNS0095599	Silvery flower (diploied) 2	3.641
	CNS0095600	Silvery flower (diploied) 3	5.635
	CNS0095601	Golden flower (diploid) 1	2.390
	CNS0095602	Golden flower (diploid) 2	8.479
	CNS0095603	Golden flower (diploid) 3	7.318
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.974
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.631
	CNS0095606	Slightly white alabastrum(tetraploid) 3	20.376
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.061
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.744
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.006
	CNS0095610	Silvery flower (tetraploid) 1	7.163
	CNS0095611	Silvery flower (tetraploid) 2	5.024
	CNS0095612	Silvery flower (tetraploid) 3	8.653
	CNS0095613	Golden flower (tetraploid) 1	12.992
	CNS0095614	Golden flower (tetraploid) 2	13.501
	CNS0095615	Golden flower (tetraploid) 3	7.146
CRA001975	CRR073297	Stem 1	8.216
	CRR073298	Stem 2	11.486
	CRR073299	Stem 3	14.936
	CRR073300	Leaf 1	20.836
	CRR073301	Leaf 2	19.771
	CRR073302	Leaf 3	10.221
	CRR073303	Juvenile bud 1	19.153
	CRR073304	Juvenile bud 2	12.724
	CRR073305	Juvenile bud 3	54.286
	CRR073306	Third green 1	4.839
	CRR073307	Third green 2	5.554
	CRR073308	Third green 3	7.536
	CRR073309	Second white 1	8.249
	CRR073310	Second white 2	5.746
	CRR073311	Second white 3	7.581
	CRR073312	Silver flowering 1	8.362
	CRR073313	Silver flowering 2	6.872
	CRR073314	Silver flowering 3	7.342
	CRR073315	Gold flowering 1	21.403
	CRR073316	Gold flowering 2	20.229
	CRR073317	Gold flowering 3	25.080
	CRR073318	Tawny withering 1	15.277
	CRR073319	Tawny withering 2	13.366
	CRR073320	Tawny withering 3	13.827