Gene detail

Detail information of GWHGAAZE003845

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU18107.1	1.47387E-79	hypothetical protein MIMGU_mgv1a019805mg [Erythranthe guttata]
Swissprot	tr\|Q9ZSD4\|SY121_ARATH	1E-63	Syntaxin-121
trEMBL	tr\|A0A022PP81\|A0A022PP81_ERYGU	5E-80	Uncharacterized protein {ECO:0000313\|EMBL:EYU18107.1}
TAIR10	AT3G11820.2	2E-52	syntaxin of plants 121

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	105617539	105618006	+
GWHAAZE00000001	mRNA	105617539	105618006	+
GWHAAZE00000001	exon	105617539	105617745	+
GWHAAZE00000001	exon	105617776	105618006	+
GWHAAZE00000001	CDS	105617539	105617745	+
GWHAAZE00000001	CDS	105617776	105618006	+

Transcript Sequence
>GWHTAAZE003851 ATGAATTTATTCAACGACCTCCGTCAGAGGATGGCGGAGGAGTATAGGGACACGGTCCAACGCCGCTACTTCACTGTAACCGGGGAGAACGCGGATGAGAACACCGTGGATTCGCTGATTGCGACTGGGCAGAGCGAGACTTTTCTGCAAAAGGCGATCCAGGAGCAAGGGCGAGGGCAAGTGATGGACACTATAATGGAGATCCAGAAGAATCTGAGAGAACTTCATCAAGTTTTTATGGACATGGCGGTATTGGTTGAGAGCCAAGGAGAACAGCTAGACGATATCGAGAGTCAGGTGGCTAGAGCTAGCTCGTTCGTTCGAGGTGGGGCTCAGCAACTCCAAGTAGCGAGAAAGCACCAGAAAAATACCAGAAAGTGGGCTTGCTTTGGTATTATTTTGTTGTTGGTGGTCATCGCCATTGTTATCTTGTCGCTT

Network for GWHGAAZE003845

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00804.26	Syntaxin	1	90	3.30E-29
PF05739.20	SNARE	91	143	1.30E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08486	STX1B_2_3	SNARE interactions in vesicular transport	map04130
K08486	STX1B_2_3	Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	165.782
	SRR3591706	second leaf	42.697
	SRR3591707	mature leaf	23.103
	SRR3591708	Shoot apex	106.492
	SRR3591709	Stem	249.979
	SRR3591710	White floral bud	113.634
	SRR3591711	White flower	169.349
	SRR3591712	Green floral bud	69.044
	SRR3591713	Yellow flower	170.481
SRP173429	SRR8316895	Juvenile bud stage	145.406
	SRR8316896	Juvenile bud stage	114.474
	SRR8316897	Juvenile bud stage	91.843
	SRR8316894	Third green stage	38.801
	SRR8316900	Third green stage	60.872
	SRR8316901	Third green stage	112.605
	SRR8316898	Complete white stage	10.940
	SRR8316899	Complete white stage	228.124
	SRR8316903	Complete white stage	17.969
	SRR8316902	Silver flowering stage	23.690
	SRR8316904	Silver flowering stage	17.692
	SRR8316905	Silver flowering stage	16.591
	SRR8316906	Gold flowering stage	120.663
	SRR8316907	Gold flowering stage	100.430
	SRR8316908	Gold flowering stage	126.215
SRP132670	SRR6706286	Control	28.370
	SRR6706287	Light intensity 50%	39.198
	SRR6706288	Light intensity 20%	29.257
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	131.105
	CNS0095593	Slightly white alabastrum(diploid) 2	170.288
	CNS0095594	Slightly white alabastrum(diploid) 3	150.835
	CNS0095595	Whole white alabastrum(diploid) 2	84.251
	CNS0095596	Whole white alabastrum(diploid) 3	23.746
	CNS0095597	Whole white alabastrum(diploid) 4	96.346
	CNS0095598	Silvery flower (diploied) 1	347.684
	CNS0095599	Silvery flower (diploied) 2	216.880
	CNS0095600	Silvery flower (diploied) 3	131.748
	CNS0095601	Golden flower (diploid) 1	326.033
	CNS0095602	Golden flower (diploid) 2	212.748
	CNS0095603	Golden flower (diploid) 3	203.144
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.308
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.939
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.754
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.648
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.111
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.290
	CNS0095610	Silvery flower (tetraploid) 1	40.043
	CNS0095611	Silvery flower (tetraploid) 2	16.785
	CNS0095612	Silvery flower (tetraploid) 3	73.592
	CNS0095613	Golden flower (tetraploid) 1	82.843
	CNS0095614	Golden flower (tetraploid) 2	50.012
	CNS0095615	Golden flower (tetraploid) 3	67.140
CRA001975	CRR073297	Stem 1	68.943
	CRR073298	Stem 2	89.462
	CRR073299	Stem 3	107.750
	CRR073300	Leaf 1	164.105
	CRR073301	Leaf 2	215.465
	CRR073302	Leaf 3	144.429
	CRR073303	Juvenile bud 1	186.262
	CRR073304	Juvenile bud 2	146.535
	CRR073305	Juvenile bud 3	370.124
	CRR073306	Third green 1	71.219
	CRR073307	Third green 2	79.944
	CRR073308	Third green 3	71.647
	CRR073309	Second white 1	64.930
	CRR073310	Second white 2	82.333
	CRR073311	Second white 3	85.035
	CRR073312	Silver flowering 1	311.698
	CRR073313	Silver flowering 2	278.705
	CRR073314	Silver flowering 3	235.290
	CRR073315	Gold flowering 1	115.986
	CRR073316	Gold flowering 2	131.473
	CRR073317	Gold flowering 3	203.247
	CRR073318	Tawny withering 1	160.910
	CRR073319	Tawny withering 2	304.046
	CRR073320	Tawny withering 3	260.893