Gene detail

Detail information of GWHGAAZE003810

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004497675.1	3.9353E-140	PREDICTED: 2-Cys peroxiredoxin BAS1, chloroplastic-like [Cicer arietinum]
COG	YP_007117340.1	8E-106	Peroxiredoxin
Swissprot	tr\|Q96291\|BAS1A_ARATH	2E-135	2-Cys peroxiredoxin BAS1, chloroplastic (Precursor)
trEMBL	tr\|G7IE32\|G7IE32_MEDTR	1E-138	Uncharacterized protein {ECO:0000313\|EMBL:AFK48931.1}
TAIR10	AT3G11630.1	2E-107	Thioredoxin superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	104812223	104815418	+
GWHAAZE00000001	mRNA	104812223	104815418	+
GWHAAZE00000001	exon	104812223	104812327	+
GWHAAZE00000001	exon	104813141	104813222	+
GWHAAZE00000001	exon	104813335	104813414	+
GWHAAZE00000001	exon	104814143	104814268	+
GWHAAZE00000001	exon	104814397	104814510	+
GWHAAZE00000001	exon	104815302	104815418	+
GWHAAZE00000001	CDS	104812223	104812327	+
GWHAAZE00000001	CDS	104813141	104813222	+
GWHAAZE00000001	CDS	104813335	104813414	+
GWHAAZE00000001	CDS	104814143	104814268	+
GWHAAZE00000001	CDS	104814397	104814510	+
GWHAAZE00000001	CDS	104815302	104815418	+

Transcript Sequence
>GWHTAAZE003816 ATGCATCATCTCATTTCTCTCTGTGCACAGAGTGAACTTCCACTGGTTGGAAATGTAGCACCAGACTTTGAGGCAGAGGCTGTATTTGACCAGGAGTTCATCAAGGTTAAACTCTCGGATTACATTGGGAAGAAATATGTCATTCTCTTTTTCTACCCTTTGGACTTCACATTTGTTTGTCCAACAGAGATCACTGCTTTCAGTGACCGTCATGCTGAATTTGACAAGATAAACACAGAAATCCTGGGTGTTTCCGTAGATAGTGTGTTCTCCCATCTTGCTTGGGTTCAAACAGATAGAAAGTCTGGGGGACTAGGTGATCTAAACTATCCATTGGTTTCCGATGTGACCAAATCAATTGCTAAATCATATGGCGTGTTGATTGAAGATCAGGGAATTGCATTGAGAGGACTTTTTATCATTGACAAGGAAGGGGTTATCCAACACTCCACCATTAACAATCTTGCGATTGGCCGAAGTGTTGATGAGACAAAGAGAACCCTACAGGCGTTGCAATACGTGCAGGAGAACCCGGATGAGGTATGCCCGGCTGGATGGAAGCCAGGGGAGAAGTCAATGAAGCCAGACCCCAAGCTCAGCAAGGACTACTTTGCAGCTGTATGA

Network for GWHGAAZE003810

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00578.22	AhpC-TSA	16	149	1.10E-40
PF10417.10	1-cysPrx_C	170	204	2.40E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03386	PRDX2_4, ahpC	Apoptosis - fly	map04214

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0045454	biological_process	cell redox homeostasis
GO:0051920	molecular_function	peroxiredoxin activity
GO:0016209	molecular_function	antioxidant activity
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	544.086
	SRR3591706	second leaf	1602.998
	SRR3591707	mature leaf	581.367
	SRR3591708	Shoot apex	1033.091
	SRR3591709	Stem	217.005
	SRR3591710	White floral bud	153.830
	SRR3591711	White flower	190.457
	SRR3591712	Green floral bud	274.196
	SRR3591713	Yellow flower	204.261
SRP173429	SRR8316895	Juvenile bud stage	345.877
	SRR8316896	Juvenile bud stage	338.795
	SRR8316897	Juvenile bud stage	286.237
	SRR8316894	Third green stage	171.462
	SRR8316900	Third green stage	526.374
	SRR8316901	Third green stage	429.828
	SRR8316898	Complete white stage	102.134
	SRR8316899	Complete white stage	291.044
	SRR8316903	Complete white stage	149.215
	SRR8316902	Silver flowering stage	110.123
	SRR8316904	Silver flowering stage	117.722
	SRR8316905	Silver flowering stage	61.256
	SRR8316906	Gold flowering stage	203.021
	SRR8316907	Gold flowering stage	225.857
	SRR8316908	Gold flowering stage	251.982
SRP132670	SRR6706286	Control	240.318
	SRR6706287	Light intensity 50%	239.149
	SRR6706288	Light intensity 20%	292.679
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	263.434
	CNS0095593	Slightly white alabastrum(diploid) 2	216.761
	CNS0095594	Slightly white alabastrum(diploid) 3	196.621
	CNS0095595	Whole white alabastrum(diploid) 2	218.599
	CNS0095596	Whole white alabastrum(diploid) 3	257.488
	CNS0095597	Whole white alabastrum(diploid) 4	159.514
	CNS0095598	Silvery flower (diploied) 1	307.658
	CNS0095599	Silvery flower (diploied) 2	321.058
	CNS0095600	Silvery flower (diploied) 3	208.066
	CNS0095601	Golden flower (diploid) 1	249.971
	CNS0095602	Golden flower (diploid) 2	233.495
	CNS0095603	Golden flower (diploid) 3	221.402
	CNS0095604	Slightly white alabastrum(tetraploid) 1	284.365
	CNS0095605	Slightly white alabastrum(tetraploid) 2	265.990
	CNS0095606	Slightly white alabastrum(tetraploid) 3	362.745
	CNS0095607	Whole white alabastrum(tetraploid) 1	128.622
	CNS0095608	Whole white alabastrum(tetraploid) 2	132.849
	CNS0095609	Whole white alabastrum(tetraploid) 3	348.076
	CNS0095610	Silvery flower (tetraploid) 1	206.173
	CNS0095611	Silvery flower (tetraploid) 2	291.966
	CNS0095612	Silvery flower (tetraploid) 3	263.154
	CNS0095613	Golden flower (tetraploid) 1	144.013
	CNS0095614	Golden flower (tetraploid) 2	197.432
	CNS0095615	Golden flower (tetraploid) 3	133.467
CRA001975	CRR073297	Stem 1	406.877
	CRR073298	Stem 2	362.067
	CRR073299	Stem 3	458.986
	CRR073300	Leaf 1	264.911
	CRR073301	Leaf 2	285.592
	CRR073302	Leaf 3	386.011
	CRR073303	Juvenile bud 1	308.248
	CRR073304	Juvenile bud 2	320.395
	CRR073305	Juvenile bud 3	267.300
	CRR073306	Third green 1	185.569
	CRR073307	Third green 2	102.506
	CRR073308	Third green 3	131.054
	CRR073309	Second white 1	199.532
	CRR073310	Second white 2	135.746
	CRR073311	Second white 3	108.830
	CRR073312	Silver flowering 1	145.051
	CRR073313	Silver flowering 2	150.750
	CRR073314	Silver flowering 3	136.418
	CRR073315	Gold flowering 1	1096.260
	CRR073316	Gold flowering 2	1148.014
	CRR073317	Gold flowering 3	923.316
	CRR073318	Tawny withering 1	256.707
	CRR073319	Tawny withering 2	273.336
	CRR073320	Tawny withering 3	244.466