Gene detail

Detail information of GWHGAAZE003526

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011076201.1	1.9048E-121	PREDICTED: heat stress transcription factor B-2a-like [Sesamum indicum]
Swissprot	tr\|Q9SCW4\|HFB2A_ARATH	2E-86	Heat stress transcription factor B-2a
trEMBL	tr\|A0A068VLL8\|A0A068VLL8_COFCA	9E-118	Coffea canephora DH200=94 genomic scaffold, scaffold_4602 {ECO:0000313\|EMBL:CDP21507.1}
TAIR10	AT5G62020.1	1E-69	heat shock transcription factor B2A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	99498498	99499375	-
GWHAAZE00000001	mRNA	99498498	99499375	-
GWHAAZE00000001	exon	99499121	99499375	-
GWHAAZE00000001	exon	99498498	99499031	-
GWHAAZE00000001	CDS	99499121	99499375	-
GWHAAZE00000001	CDS	99498498	99499031	-

Transcript Sequence
>GWHTAAZE003532 ATGGCCCCGCCGCTGCCGGTGGAGCAAAACGGCGCCGAATCAACGGCCGGCGACACAACCAGATCTCTGCCGACGCCTTTTTTGACTAAAACATATCAGCTCGTTGATGACGAAGCAATCGACGACGTGATTTCGTGGAATGAAGACGGATCTACCTTCATAGTATGGAATCCGACGGAGTTCGCTAGGGATTTGCTTCCGAAGTATTTCAAGCACAACAATTTCTCTAGTTTTGTTCGCCAGCTTAATACCTATGGATTTAGGAAGGTTGTACCGGATCGATGGGAATTCTCGAACGAATGCTTTCGCAGGGGAGAAAAACGTCTTTTGTGCGATATACAACGTCGGAAATTCGCGACGCCGGTTGTGTCCACACCGGTGGTGACAGTAGCGGCAGCTCCGCCGTTGCGGACAGAAACGCCGACGGATTCAGGCGAAGAGCAGGTGATTTCATCAAACTCGTCGCCGGCTACGGTTTTGTCTCTAGAACCAAGCTGCGCAAGCACATCGGAGCTAATCGGTGAAAATAAGCGATTGAAAAAGGAAAATATACAACTGAATAAAGAGCTGAGCCAGATGAAAAACTTGTGCAATAACATATACGCTTTGATGTCAAATTATGCCGTTAATCAGCCGGAGAGCAATCCTCAGCAACAAGCTGTAACCCCGCTTGATCTGATGCCGTCCGGAAAGCAGATCGACGATTATCGTGTCGGCTCTCATGAAAATAATAACGACAGAGAAGAAAGTCCTAGATTATTCGGTGTTGCTATTGGTTTGAAACGTAGC

Network for GWHGAAZE003526

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00447.18	HSF_DNA-bind	27	116	1.70E-33

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HSF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	71.601
	SRR3591706	second leaf	47.636
	SRR3591707	mature leaf	83.800
	SRR3591708	Shoot apex	47.386
	SRR3591709	Stem	63.581
	SRR3591710	White floral bud	64.352
	SRR3591711	White flower	80.890
	SRR3591712	Green floral bud	41.509
	SRR3591713	Yellow flower	81.386
SRP173429	SRR8316895	Juvenile bud stage	47.427
	SRR8316896	Juvenile bud stage	73.953
	SRR8316897	Juvenile bud stage	42.956
	SRR8316894	Third green stage	21.654
	SRR8316900	Third green stage	62.601
	SRR8316901	Third green stage	79.642
	SRR8316898	Complete white stage	74.654
	SRR8316899	Complete white stage	120.596
	SRR8316903	Complete white stage	96.239
	SRR8316902	Silver flowering stage	102.795
	SRR8316904	Silver flowering stage	92.196
	SRR8316905	Silver flowering stage	55.227
	SRR8316906	Gold flowering stage	183.499
	SRR8316907	Gold flowering stage	202.196
	SRR8316908	Gold flowering stage	162.599
SRP132670	SRR6706286	Control	53.226
	SRR6706287	Light intensity 50%	49.894
	SRR6706288	Light intensity 20%	46.680
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.486
	CNS0095593	Slightly white alabastrum(diploid) 2	36.602
	CNS0095594	Slightly white alabastrum(diploid) 3	25.557
	CNS0095595	Whole white alabastrum(diploid) 2	30.152
	CNS0095596	Whole white alabastrum(diploid) 3	20.935
	CNS0095597	Whole white alabastrum(diploid) 4	30.469
	CNS0095598	Silvery flower (diploied) 1	42.462
	CNS0095599	Silvery flower (diploied) 2	82.668
	CNS0095600	Silvery flower (diploied) 3	159.491
	CNS0095601	Golden flower (diploid) 1	95.760
	CNS0095602	Golden flower (diploid) 2	151.928
	CNS0095603	Golden flower (diploid) 3	155.825
	CNS0095604	Slightly white alabastrum(tetraploid) 1	39.641
	CNS0095605	Slightly white alabastrum(tetraploid) 2	36.773
	CNS0095606	Slightly white alabastrum(tetraploid) 3	60.459
	CNS0095607	Whole white alabastrum(tetraploid) 1	43.532
	CNS0095608	Whole white alabastrum(tetraploid) 2	38.866
	CNS0095609	Whole white alabastrum(tetraploid) 3	45.522
	CNS0095610	Silvery flower (tetraploid) 1	104.000
	CNS0095611	Silvery flower (tetraploid) 2	119.881
	CNS0095612	Silvery flower (tetraploid) 3	117.079
	CNS0095613	Golden flower (tetraploid) 1	130.255
	CNS0095614	Golden flower (tetraploid) 2	126.664
	CNS0095615	Golden flower (tetraploid) 3	102.000
CRA001975	CRR073297	Stem 1	28.223
	CRR073298	Stem 2	29.365
	CRR073299	Stem 3	28.487
	CRR073300	Leaf 1	67.707
	CRR073301	Leaf 2	70.854
	CRR073302	Leaf 3	49.299
	CRR073303	Juvenile bud 1	72.383
	CRR073304	Juvenile bud 2	79.367
	CRR073305	Juvenile bud 3	63.846
	CRR073306	Third green 1	188.497
	CRR073307	Third green 2	158.158
	CRR073308	Third green 3	137.026
	CRR073309	Second white 1	98.369
	CRR073310	Second white 2	164.228
	CRR073311	Second white 3	114.091
	CRR073312	Silver flowering 1	93.988
	CRR073313	Silver flowering 2	73.489
	CRR073314	Silver flowering 3	89.407
	CRR073315	Gold flowering 1	56.075
	CRR073316	Gold flowering 2	72.552
	CRR073317	Gold flowering 3	55.283
	CRR073318	Tawny withering 1	84.064
	CRR073319	Tawny withering 2	113.071
	CRR073320	Tawny withering 3	87.199