Gene detail

Detail information of GWHGAAZE003508

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010662529.1	8.39444E-68	PREDICTED: ethylene-responsive transcription factor ERF027 [Vitis vinifera]
Swissprot	tr\|Q9FJ90\|ERF25_ARATH	1E-54	Ethylene-responsive transcription factor ERF025
trEMBL	tr\|F6HP68\|F6HP68_VITVI	3E-68	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB56474.1}
TAIR10	AT5G52020.1	2E-38	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	99229510	99230184	-
GWHAAZE00000001	mRNA	99229510	99230184	-
GWHAAZE00000001	exon	99229510	99230184	-
GWHAAZE00000001	CDS	99229510	99230184	-

Transcript Sequence
>GWHTAAZE003514 ATGGCTAACCCTGCTAACGTACGCCAAGATGATCAATCCCCAAATCCCCCTTTATTACATTCTCCCAAACCAACCCTCTCTGTTCACCCCCCAAATGAACAAACACCCAACTCTTCTTTTTCGAGCACTTCACCCCAACCACCCATAACCACCATTGCCTCCCCCTCCACCACCACCACCACCACCACCACCGGAAAACATCCCAACTTTAGAGGAATCCGGTGCCGGAGTGGTAAATGGGTATCTGAAATACGCGAGCCACGTAAGACTACGCGTATATGGCTCGGCACGTACCCCACTCCAGAGATGGCAGCGGCCGCCTATGACGTGGCTGCCTTAGCACTTAAAGGCCCTGATGCCGTCCTAAATTTCCCCAATTCGATTTTTGAGTATGACGTACCGGACACTCCGTCAGCCCCCGAGATACGTGCAGCCGCGGCCAGGGCGGCGGCTTCCAGAGCACCTAAACCGGAAAGTACCGGAAGCGCTGTAGATATTGGGGCTGCGAATGAGAATACGCCATCTGGCGAAGGATTTATGGACGAGGAGGAAATATTTGATATGCCCAATTTACTAGTGGATATGGCAGAGGGAATGCTAGTAAGTCCACCGAGGATCAAATCCGATGACTCGCCGGAGAATTCTGATGGAGACAGTTTGTGGAATTATCCTTGA

Network for GWHGAAZE003508

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	68	117	1.30E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	70.090
	SRR3591706	second leaf	5.798
	SRR3591707	mature leaf	1.864
	SRR3591708	Shoot apex	13.865
	SRR3591709	Stem	14.990
	SRR3591710	White floral bud	4.476
	SRR3591711	White flower	8.980
	SRR3591712	Green floral bud	4.214
	SRR3591713	Yellow flower	7.983
SRP173429	SRR8316895	Juvenile bud stage	52.012
	SRR8316896	Juvenile bud stage	55.604
	SRR8316897	Juvenile bud stage	47.728
	SRR8316894	Third green stage	1.798
	SRR8316900	Third green stage	3.604
	SRR8316901	Third green stage	13.001
	SRR8316898	Complete white stage	0.100
	SRR8316899	Complete white stage	14.876
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.117
	SRR8316904	Silver flowering stage	0.102
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.862
	SRR8316907	Gold flowering stage	0.572
	SRR8316908	Gold flowering stage	1.124
SRP132670	SRR6706286	Control	0.725
	SRR6706287	Light intensity 50%	0.571
	SRR6706288	Light intensity 20%	0.423
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.695
	CNS0095593	Slightly white alabastrum(diploid) 2	31.237
	CNS0095594	Slightly white alabastrum(diploid) 3	50.223
	CNS0095595	Whole white alabastrum(diploid) 2	30.754
	CNS0095596	Whole white alabastrum(diploid) 3	0.562
	CNS0095597	Whole white alabastrum(diploid) 4	12.957
	CNS0095598	Silvery flower (diploied) 1	64.697
	CNS0095599	Silvery flower (diploied) 2	110.048
	CNS0095600	Silvery flower (diploied) 3	35.665
	CNS0095601	Golden flower (diploid) 1	63.225
	CNS0095602	Golden flower (diploid) 2	68.956
	CNS0095603	Golden flower (diploid) 3	67.757
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.514
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.109
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.434
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.123
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.149
	CNS0095611	Silvery flower (tetraploid) 2	0.058
	CNS0095612	Silvery flower (tetraploid) 3	0.480
	CNS0095613	Golden flower (tetraploid) 1	0.401
	CNS0095614	Golden flower (tetraploid) 2	0.075
	CNS0095615	Golden flower (tetraploid) 3	0.909
CRA001975	CRR073297	Stem 1	22.389
	CRR073298	Stem 2	22.545
	CRR073299	Stem 3	27.571
	CRR073300	Leaf 1	23.902
	CRR073301	Leaf 2	45.956
	CRR073302	Leaf 3	10.512
	CRR073303	Juvenile bud 1	10.901
	CRR073304	Juvenile bud 2	24.009
	CRR073305	Juvenile bud 3	24.849
	CRR073306	Third green 1	24.168
	CRR073307	Third green 2	31.372
	CRR073308	Third green 3	16.933
	CRR073309	Second white 1	22.597
	CRR073310	Second white 2	17.943
	CRR073311	Second white 3	17.179
	CRR073312	Silver flowering 1	33.100
	CRR073313	Silver flowering 2	45.492
	CRR073314	Silver flowering 3	24.020
	CRR073315	Gold flowering 1	44.914
	CRR073316	Gold flowering 2	108.645
	CRR073317	Gold flowering 3	94.861
	CRR073318	Tawny withering 1	25.030
	CRR073319	Tawny withering 2	132.529
	CRR073320	Tawny withering 3	7.449