Gene detail

Detail information of GWHGAAZE003507

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010278525.1	3.00781E-60	PREDICTED: ethylene-responsive transcription factor ERF026-like [Nelumbo nucifera]
Swissprot	tr\|Q9FJ90\|ERF25_ARATH	1E-48	Ethylene-responsive transcription factor ERF025
trEMBL	tr\|F6HP68\|F6HP68_VITVI	4E-60	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB56474.1}
TAIR10	AT5G52020.1	6E-36	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	99210831	99211523	-
GWHAAZE00000001	mRNA	99210831	99211523	-
GWHAAZE00000001	exon	99210831	99211523	-
GWHAAZE00000001	CDS	99210831	99211523	-

Transcript Sequence
>GWHTAAZE003513 ATGAACAATCCAAGCGTAAACCGGAGAAAAAAAGAAAGAAAGAACAACAATCCCAAGCCAACCCCCATTTTACAAGCCCCTCAGTCTTCCCCCCCACAAAGGAATAAGCACAAGGTGGACCTTAATTGTCAAACGTACGCACCTCCACAAAATCACCCCCAACAAGCCATAACCACCACTAACCCCCCCTCCGGGGGCACCGGAAGCCTTCAAAACTATAGAGGAATCCGGTGCCGGTGTGGTAAATGGGTATCGGAAATACGTGAGCCACGTAAAACTAAGCGTATATGGCTAGGCACGTACCCCACACCTGAGATGGCAGCTGCCGCCTACGACGTGGCGGCCTTAGCACTTAAAGGACCTGAGGCCGTCCTAAATTTCCCTGATTCCGTTCTTTCTTATATAATTCCCGATTCTCCTTCTTCCAGCGAAATACGAGCTGCGGCGGGCCTTGCTGCGGCTTCTAGAGGGCGTGTAGCTGAAACTAGTGGAAGCGCAGTTGATATTGAGGGTGGAAATGAGAGCACGCCATCTGGCGAAGAATTTATGGACGAGGAAGCACTATATGATATGCCGAATTTTCTGATGAACATGGCACAGGGGATGCTTTTAAGCCCGCCCAGGTTGAAATTGCATCCGTCCAATGGCTCTCCCGAGAATTCTGACGGAGAGAGTCTATGGAGCTATCGTTAA

Network for GWHGAAZE003507

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	73	120	1.90E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.246
	SRR3591712	Green floral bud	0.158
	SRR3591713	Yellow flower	0.140
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.098
	SRR8316900	Third green stage	0.153
	SRR8316901	Third green stage	0.373
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.148
	SRR8316902	Silver flowering stage	0.141
	SRR8316904	Silver flowering stage	0.340
	SRR8316905	Silver flowering stage	0.125
	SRR8316906	Gold flowering stage	0.323
	SRR8316907	Gold flowering stage	0.265
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.037
	SRR6706287	Light intensity 50%	0.068
	SRR6706288	Light intensity 20%	0.070
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.298
	CNS0095594	Slightly white alabastrum(diploid) 3	0.187
	CNS0095595	Whole white alabastrum(diploid) 2	0.493
	CNS0095596	Whole white alabastrum(diploid) 3	0.340
	CNS0095597	Whole white alabastrum(diploid) 4	0.167
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.133
	CNS0095600	Silvery flower (diploied) 3	0.170
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.076
	CNS0095603	Golden flower (diploid) 3	0.215
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.127
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.129
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.136
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.307
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.169
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.163
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.292
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.008
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.131
	CRR073302	Leaf 3	0.034
	CRR073303	Juvenile bud 1	0.324
	CRR073304	Juvenile bud 2	0.050
	CRR073305	Juvenile bud 3	0.094
	CRR073306	Third green 1	1.665
	CRR073307	Third green 2	1.198
	CRR073308	Third green 3	0.848
	CRR073309	Second white 1	0.385
	CRR073310	Second white 2	0.176
	CRR073311	Second white 3	0.440
	CRR073312	Silver flowering 1	0.062
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.262
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.122
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.142
	CRR073320	Tawny withering 3	0.486