Gene detail

Detail information of GWHGAAZE003482

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002271141.1	8.97204E-41	PREDICTED: transcription factor bHLH118 [Vitis vinifera]
Swissprot	tr\|Q9FLI0\|BH120_ARATH	1E-27	Transcription factor bHLH120
trEMBL	tr\|F6HAQ7\|F6HAQ7_VITVI	2E-41	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB49239.1}
TAIR10	AT5G51790.1	2E-23	basic helix-loop-helix (bHLH) DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	98687675	98689887	+
GWHAAZE00000001	mRNA	98687675	98689887	+
GWHAAZE00000001	exon	98687675	98687908	+
GWHAAZE00000001	exon	98689516	98689719	+
GWHAAZE00000001	exon	98689822	98689887	+
GWHAAZE00000001	CDS	98687675	98687908	+
GWHAAZE00000001	CDS	98689516	98689719	+
GWHAAZE00000001	CDS	98689822	98689887	+

Transcript Sequence
>GWHTAAZE003488 ATGGATCGTGATCATGATGATTCTACGAATTTCATCGCCCCGAACAACATGAGAAAACGGCTCCACCGGAACTCATCATCAGCCTCTGCCGGAGACAAAGCCAACGGCGAAAAAAGTAGTAATGATAACAAGCAGAAAAGAGTCATGCACAGAGACATTGAAAGGCAGAGAAGACAAGAAATGGCTAAACTCTATGCATCACTTCGCTCTCTACTCCCTCTTGAATATGTCAAGGGAAAATCGAATAATTATTTGGGTAATATTGTTACAGTGAGCTCATGCTGGTGTGGTGTTGAGATTTTGGTGAGTAGCAGTTTAGTGGAGAAAGGATTTCCCCTATCAAGAGTGATGGAAATATTGATTGAAGAAGGGCTTAGTGTTGTTAGCTGTTTCTCCACTAAAGTAAATGAAAGATTGCTCCACACTATTCAATCTGAGGTCGGGGATCTAACACGCATTGATCTATCTGCGCTACAACAAAAACTGAACGAACAATGTAACTAA

Network for GWHGAAZE003482

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00010.27	HLH	46	78	1.90E-06

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bHLH

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0046983	molecular_function	protein dimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.406
	SRR3591706	second leaf	0.245
	SRR3591707	mature leaf	0.309
	SRR3591708	Shoot apex	0.900
	SRR3591709	Stem	3.867
	SRR3591710	White floral bud	4.016
	SRR3591711	White flower	4.273
	SRR3591712	Green floral bud	0.781
	SRR3591713	Yellow flower	0.216
SRP173429	SRR8316895	Juvenile bud stage	0.834
	SRR8316896	Juvenile bud stage	4.018
	SRR8316897	Juvenile bud stage	0.932
	SRR8316894	Third green stage	0.882
	SRR8316900	Third green stage	3.031
	SRR8316901	Third green stage	3.346
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.131
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.453
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.007
	SRR8316907	Gold flowering stage	0.187
	SRR8316908	Gold flowering stage	0.109
SRP132670	SRR6706286	Control	0.843
	SRR6706287	Light intensity 50%	0.836
	SRR6706288	Light intensity 20%	0.653
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.117
	CNS0095593	Slightly white alabastrum(diploid) 2	0.803
	CNS0095594	Slightly white alabastrum(diploid) 3	4.354
	CNS0095595	Whole white alabastrum(diploid) 2	1.124
	CNS0095596	Whole white alabastrum(diploid) 3	0.808
	CNS0095597	Whole white alabastrum(diploid) 4	0.776
	CNS0095598	Silvery flower (diploied) 1	0.836
	CNS0095599	Silvery flower (diploied) 2	0.752
	CNS0095600	Silvery flower (diploied) 3	0.384
	CNS0095601	Golden flower (diploid) 1	0.677
	CNS0095602	Golden flower (diploid) 2	0.116
	CNS0095603	Golden flower (diploid) 3	0.559
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.217
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.443
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.175
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.079
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.365
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.809
	CNS0095610	Silvery flower (tetraploid) 1	0.240
	CNS0095611	Silvery flower (tetraploid) 2	0.183
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.132
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.115
	CRR073298	Stem 2	1.318
	CRR073299	Stem 3	0.336
	CRR073300	Leaf 1	0.655
	CRR073301	Leaf 2	0.539
	CRR073302	Leaf 3	0.591
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.070
	CRR073308	Third green 3	0.128
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.123
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	2.515
	CRR073319	Tawny withering 2	2.385
	CRR073320	Tawny withering 3	2.057