Gene detail

Detail information of GWHGAAZE003273

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011084942.1	4.96906E-44	PREDICTED: probable signal peptidase complex subunit 2 [Sesamum indicum]
Swissprot	tr\|P58684\|SPCS2_ARATH	4E-37	Probable signal peptidase complex subunit 2
trEMBL	tr\|A0A022RQP1\|A0A022RQP1_ERYGU	1E-43	Uncharacterized protein {ECO:0000313\|EMBL:EYU41260.1}
TAIR10	AT2G39960.1	1E-30	Microsomal signal peptidase 25 kDa subunit (SPC25)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	95074352	95077616	-
GWHAAZE00000001	mRNA	95074352	95077616	-
GWHAAZE00000001	exon	95077606	95077616	-
GWHAAZE00000001	exon	95077356	95077464	-
GWHAAZE00000001	exon	95076759	95076901	-
GWHAAZE00000001	exon	95074352	95074724	-
GWHAAZE00000001	CDS	95077606	95077616	-
GWHAAZE00000001	CDS	95077356	95077464	-
GWHAAZE00000001	CDS	95076759	95076901	-
GWHAAZE00000001	CDS	95074628	95074724	-
GWHAAZE00000001	three_prime_UTR	95074352	95074627	-

Transcript Sequence
>GWHTAAZE003279 ATGCTTTATAGTGCATCTCCAAAGGGGCAACCGAACTTTGTTATGGTAACAGAACCTGATGGAATATATGAAGGCCAGAGCTTTGTTTACCCTTGTGAACAAAGTCTCTTGAAAACATCAGGATCCTTTAACAGCACTGGCTTGGTGGTTTCTTCCAAGTTGCCAAGATTCTCTGATATGTATACGCTTACCATAGCAAGTTCTGACCCACAATCAATATCTGCAAAGCCACCGGTGGAACTCACCAAAAGTGTTACCCAATGGTTCACAAAGGAGGGAGTTCTGGTGGAGGGTCTGTTCTGGAAAGACGTTGAAGGACTAGTAAATGATTATGCAAAAGAAGCTAAAAAGAGCAAGTGAACACAATCAGGCATGTGAGAGAGCGAGCGAGAGTCTGTTGCTGATAGGATCCTAGTGGGGACAGAAAGAGCTTAAGTAATATTTTTACCAAACCATAGCTGGTGTTTATTAAGAAATTGTGGTTTCTTGTTTTAATCGATTATGAACGTACAACTATGGAATCAATATTACAACACATTGAGAAGAAGTCACAGTGTCACACCTTTAGGTTTAGCTGATTAACTGTCGCTGCCAGTGCAGTTGCTTCAGTACCATCAATTATATTCTGGTTGATTT

Network for GWHGAAZE003273

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06703.12	SPC25	41	108	1.10E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12947	SPCS2, SPC2	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006465	biological_process	signal peptide processing
GO:0005787	cellular_component	signal peptidase complex
GO:0016021	cellular_component	integral component of membrane
GO:0008233	molecular_function	peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	76.568
	SRR3591706	second leaf	26.822
	SRR3591707	mature leaf	32.841
	SRR3591708	Shoot apex	54.564
	SRR3591709	Stem	75.515
	SRR3591710	White floral bud	79.779
	SRR3591711	White flower	93.962
	SRR3591712	Green floral bud	80.833
	SRR3591713	Yellow flower	74.123
SRP173429	SRR8316895	Juvenile bud stage	30.607
	SRR8316896	Juvenile bud stage	43.988
	SRR8316897	Juvenile bud stage	20.626
	SRR8316894	Third green stage	18.538
	SRR8316900	Third green stage	61.922
	SRR8316901	Third green stage	60.670
	SRR8316898	Complete white stage	33.616
	SRR8316899	Complete white stage	75.616
	SRR8316903	Complete white stage	42.970
	SRR8316902	Silver flowering stage	37.540
	SRR8316904	Silver flowering stage	43.711
	SRR8316905	Silver flowering stage	19.459
	SRR8316906	Gold flowering stage	59.919
	SRR8316907	Gold flowering stage	55.400
	SRR8316908	Gold flowering stage	64.758
SRP132670	SRR6706286	Control	36.033
	SRR6706287	Light intensity 50%	36.606
	SRR6706288	Light intensity 20%	42.533
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	96.808
	CNS0095593	Slightly white alabastrum(diploid) 2	93.136
	CNS0095594	Slightly white alabastrum(diploid) 3	89.678
	CNS0095595	Whole white alabastrum(diploid) 2	86.226
	CNS0095596	Whole white alabastrum(diploid) 3	90.067
	CNS0095597	Whole white alabastrum(diploid) 4	99.387
	CNS0095598	Silvery flower (diploied) 1	84.177
	CNS0095599	Silvery flower (diploied) 2	75.776
	CNS0095600	Silvery flower (diploied) 3	78.908
	CNS0095601	Golden flower (diploid) 1	71.076
	CNS0095602	Golden flower (diploid) 2	64.408
	CNS0095603	Golden flower (diploid) 3	63.052
	CNS0095604	Slightly white alabastrum(tetraploid) 1	77.776
	CNS0095605	Slightly white alabastrum(tetraploid) 2	80.662
	CNS0095606	Slightly white alabastrum(tetraploid) 3	70.463
	CNS0095607	Whole white alabastrum(tetraploid) 1	71.130
	CNS0095608	Whole white alabastrum(tetraploid) 2	68.132
	CNS0095609	Whole white alabastrum(tetraploid) 3	66.407
	CNS0095610	Silvery flower (tetraploid) 1	87.104
	CNS0095611	Silvery flower (tetraploid) 2	76.899
	CNS0095612	Silvery flower (tetraploid) 3	72.403
	CNS0095613	Golden flower (tetraploid) 1	74.843
	CNS0095614	Golden flower (tetraploid) 2	66.769
	CNS0095615	Golden flower (tetraploid) 3	48.180
CRA001975	CRR073297	Stem 1	32.609
	CRR073298	Stem 2	31.509
	CRR073299	Stem 3	36.235
	CRR073300	Leaf 1	38.001
	CRR073301	Leaf 2	42.031
	CRR073302	Leaf 3	49.696
	CRR073303	Juvenile bud 1	56.634
	CRR073304	Juvenile bud 2	59.599
	CRR073305	Juvenile bud 3	48.398
	CRR073306	Third green 1	34.435
	CRR073307	Third green 2	46.811
	CRR073308	Third green 3	40.941
	CRR073309	Second white 1	44.242
	CRR073310	Second white 2	26.789
	CRR073311	Second white 3	26.208
	CRR073312	Silver flowering 1	24.999
	CRR073313	Silver flowering 2	26.047
	CRR073314	Silver flowering 3	20.831
	CRR073315	Gold flowering 1	28.286
	CRR073316	Gold flowering 2	24.705
	CRR073317	Gold flowering 3	26.776
	CRR073318	Tawny withering 1	60.459
	CRR073319	Tawny withering 2	64.463
	CRR073320	Tawny withering 3	66.111