Gene detail

Detail information of GWHGAAZE003253

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008464642.1	3.17513E-78	PREDICTED: 17.8 kDa class I heat shock protein-like [Cucumis melo]
COG	YP_005887446.1	4E-25	heat shock protein Hsp20
Swissprot	tr\|P27879\|HSP11_MEDSA	3E-70	18.1 kDa class I heat shock protein (Fragment)
trEMBL	tr\|H6TB47\|H6TB47_CITLA	3E-78	HSP18.1B {ECO:0000313\|EMBL:ADU55794.1}
TAIR10	AT5G59720.1	9E-43	heat shock protein 18.2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	94801620	94802033	+
GWHAAZE00000001	mRNA	94801620	94802033	+
GWHAAZE00000001	exon	94801620	94802033	+
GWHAAZE00000001	CDS	94801620	94802033	+

Transcript Sequence
>GWHTAAZE003259 ATGTTTGATCCATTTGAAGGATTCCCTTTCACGCAAACGCTGGCCAATGTCCCCAGCTCCGCCCGTGAAACAGCTGCAATCGCCAACACTCGAATTGACTGGAAAGAGACCCCAGAGGCTCACATCTTCAAGGCCGATCTGCCGGGACTGAAGAAGGAAGAAGTAAAGGTTGAGGTAGAGGATGGAAGAGTGCTTCAGATCAGTGGAGAGAGGAGCAAAGAGCAAGAGGAGAAGAATGACAAGTGGCACCGCGTGGAGAGGAGCAGCGGAAAGTTTATGAGAAGGTTCAGGTTGCCGGAGAATGCTAAGATCGATCAGGTGAAGGCGAGCATGGCGAATGGTGTTCTTACTGTGGTCGTGCCCAAGCAAGAGGAGAAGAAACCTGAGGTCAAGGCTATTGATATCTCTGGTTAA

Network for GWHGAAZE003253

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	33	136	1.00E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.937
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.144
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	1.627
	SRR3591712	Green floral bud	2.151
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	12.607
	SRR8316896	Juvenile bud stage	190.761
	SRR8316897	Juvenile bud stage	12.924
	SRR8316894	Third green stage	0.151
	SRR8316900	Third green stage	0.104
	SRR8316901	Third green stage	0.135
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.660
	SRR8316907	Gold flowering stage	0.773
	SRR8316908	Gold flowering stage	0.270
SRP132670	SRR6706286	Control	0.447
	SRR6706287	Light intensity 50%	0.092
	SRR6706288	Light intensity 20%	0.130
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.113
	CNS0095593	Slightly white alabastrum(diploid) 2	1.018
	CNS0095594	Slightly white alabastrum(diploid) 3	0.104
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.112
	CNS0095598	Silvery flower (diploied) 1	0.310
	CNS0095599	Silvery flower (diploied) 2	43.608
	CNS0095600	Silvery flower (diploied) 3	11.938
	CNS0095601	Golden flower (diploid) 1	260.166
	CNS0095602	Golden flower (diploid) 2	4.116
	CNS0095603	Golden flower (diploid) 3	4.716
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.073
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.253
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.108
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.239
	CNS0095610	Silvery flower (tetraploid) 1	0.121
	CNS0095611	Silvery flower (tetraploid) 2	0.173
	CNS0095612	Silvery flower (tetraploid) 3	0.485
	CNS0095613	Golden flower (tetraploid) 1	0.552
	CNS0095614	Golden flower (tetraploid) 2	0.377
	CNS0095615	Golden flower (tetraploid) 3	0.026
CRA001975	CRR073297	Stem 1	3.141
	CRR073298	Stem 2	0.247
	CRR073299	Stem 3	2.233
	CRR073300	Leaf 1	2.107
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.095
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.105
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.027
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.570
	CRR073316	Gold flowering 2	1.097
	CRR073317	Gold flowering 3	3.059
	CRR073318	Tawny withering 1	7.168
	CRR073319	Tawny withering 2	2.041
	CRR073320	Tawny withering 3	3.220