Gene detail

Detail information of GWHGAAZE003206

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP00100.1	3.5448E-61	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LHP2\|SL30A_ARATH	1E-21	Serine/arginine-rich SC35-like splicing factor SCL30A
trEMBL	tr\|A0A068TUY2\|A0A068TUY2_COFCA	1E-61	Coffea canephora DH200=94 genomic scaffold, scaffold_4 {ECO:0000313\|EMBL:CDP00100.1}
TAIR10	AT3G55460.1	5E-18	SC35-like splicing factor 30

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	93885382	93888487	+
GWHAAZE00000001	mRNA	93885382	93888487	+
GWHAAZE00000001	exon	93885382	93885542	+
GWHAAZE00000001	exon	93886913	93887077	+
GWHAAZE00000001	exon	93887182	93887222	+
GWHAAZE00000001	exon	93887497	93887563	+
GWHAAZE00000001	exon	93887655	93887804	+
GWHAAZE00000001	exon	93888394	93888487	+
GWHAAZE00000001	CDS	93885382	93885542	+
GWHAAZE00000001	CDS	93886913	93887077	+
GWHAAZE00000001	CDS	93887182	93887222	+
GWHAAZE00000001	CDS	93887497	93887563	+
GWHAAZE00000001	CDS	93887655	93887804	+
GWHAAZE00000001	CDS	93888394	93888487	+

Transcript Sequence
>GWHTAAZE003212 ATGAGAGGATATAGTCCTCCATACTACAGTCCTCCAAGGAGAGGATACGGTGGTCGACCAAGAAGCCCTCCACCAAGAAGGGGATATGGGGGTGACCGTGGAAGACCTAAAGAGCAAAATCACGGCAGCCTTTTAGTTCGCAACATTCCTTTGGATTGCAGGGAACCTCGTGGGTTTGCATTTGTGCAGTTTGTGGATCCTTATGATGCTTCGGAGGCTCAGTACCATATGGATGGGCAGATGTTTGCTGGGAGGGAGATATCTGTGGTTGTTGCTGCGGAGACAAGGAAAAGGCCCGAGGATATGCGTCGTAGAACTAGGTTTAGAGGACCCTCAAGCTCTGTAGGGCGGCAATCGTCATACTATGGACGATCTCGTTCCCGTTCTTTGTCCCCACGCTATCCTTCGGTATCGAGAAGTCGTCATCGATCAAGGTCCTACTCTCCTGCCCCAAGAAGAAGGCGAAGTGACTACTCCCTTTCCCCAGAAAGAAGTCAAGAAGAACGAGATGATGATCACATTCGTAGGTCATATTCTCCAGGCTATGACAATGCTGATCATCAAAGTGGTGAGACCCATGGCAAGAAATATGCATACTCATCAACAGGTCGAGTATCAAGGTCCCCATCTGGATCGAGATCTAGGTCTGCTGATGTGTTACCAAGGCGCGGCAGATAA

Network for GWHGAAZE003206

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00076.23	RRM_1	54	87	1.30E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12900	FUSIP1	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	32.607
	SRR3591706	second leaf	24.022
	SRR3591707	mature leaf	30.003
	SRR3591708	Shoot apex	40.670
	SRR3591709	Stem	43.452
	SRR3591710	White floral bud	32.343
	SRR3591711	White flower	41.189
	SRR3591712	Green floral bud	27.137
	SRR3591713	Yellow flower	52.624
SRP173429	SRR8316895	Juvenile bud stage	20.436
	SRR8316896	Juvenile bud stage	26.363
	SRR8316897	Juvenile bud stage	12.505
	SRR8316894	Third green stage	10.297
	SRR8316900	Third green stage	31.024
	SRR8316901	Third green stage	34.239
	SRR8316898	Complete white stage	14.156
	SRR8316899	Complete white stage	36.704
	SRR8316903	Complete white stage	22.789
	SRR8316902	Silver flowering stage	16.235
	SRR8316904	Silver flowering stage	21.694
	SRR8316905	Silver flowering stage	12.863
	SRR8316906	Gold flowering stage	39.205
	SRR8316907	Gold flowering stage	33.071
	SRR8316908	Gold flowering stage	37.719
SRP132670	SRR6706286	Control	36.900
	SRR6706287	Light intensity 50%	36.579
	SRR6706288	Light intensity 20%	37.332
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.050
	CNS0095593	Slightly white alabastrum(diploid) 2	29.851
	CNS0095594	Slightly white alabastrum(diploid) 3	24.537
	CNS0095595	Whole white alabastrum(diploid) 2	26.488
	CNS0095596	Whole white alabastrum(diploid) 3	27.445
	CNS0095597	Whole white alabastrum(diploid) 4	22.656
	CNS0095598	Silvery flower (diploied) 1	40.231
	CNS0095599	Silvery flower (diploied) 2	30.884
	CNS0095600	Silvery flower (diploied) 3	33.294
	CNS0095601	Golden flower (diploid) 1	42.080
	CNS0095602	Golden flower (diploid) 2	32.062
	CNS0095603	Golden flower (diploid) 3	36.401
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.780
	CNS0095605	Slightly white alabastrum(tetraploid) 2	35.227
	CNS0095606	Slightly white alabastrum(tetraploid) 3	60.806
	CNS0095607	Whole white alabastrum(tetraploid) 1	24.323
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.740
	CNS0095609	Whole white alabastrum(tetraploid) 3	37.097
	CNS0095610	Silvery flower (tetraploid) 1	52.623
	CNS0095611	Silvery flower (tetraploid) 2	52.237
	CNS0095612	Silvery flower (tetraploid) 3	38.066
	CNS0095613	Golden flower (tetraploid) 1	47.775
	CNS0095614	Golden flower (tetraploid) 2	61.483
	CNS0095615	Golden flower (tetraploid) 3	58.376
CRA001975	CRR073297	Stem 1	36.290
	CRR073298	Stem 2	33.333
	CRR073299	Stem 3	25.576
	CRR073300	Leaf 1	33.715
	CRR073301	Leaf 2	40.303
	CRR073302	Leaf 3	21.880
	CRR073303	Juvenile bud 1	30.206
	CRR073304	Juvenile bud 2	17.430
	CRR073305	Juvenile bud 3	31.576
	CRR073306	Third green 1	10.164
	CRR073307	Third green 2	12.255
	CRR073308	Third green 3	11.005
	CRR073309	Second white 1	17.026
	CRR073310	Second white 2	9.744
	CRR073311	Second white 3	11.536
	CRR073312	Silver flowering 1	10.671
	CRR073313	Silver flowering 2	11.587
	CRR073314	Silver flowering 3	7.772
	CRR073315	Gold flowering 1	17.601
	CRR073316	Gold flowering 2	18.716
	CRR073317	Gold flowering 3	17.414
	CRR073318	Tawny withering 1	27.627
	CRR073319	Tawny withering 2	25.701
	CRR073320	Tawny withering 3	34.759