Gene detail

Detail information of GWHGAAZE003173

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006436065.1	1.21328E-91	hypothetical protein CICLE_v10032980mg [Citrus clementina]
COG	NP_579552.1	1E-20	50S ribosomal protein L23
Swissprot	tr\|Q9AT35\|RL23A_DAUCA	1E-84	60S ribosomal protein L23a
trEMBL	tr\|A0A067FK20\|A0A067FK20_CITSI	5E-92	Uncharacterized protein {ECO:0000313\|EMBL:KDO67734.1}
TAIR10	AT2G39460.2	1E-42	ribosomal protein L23AA

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	93281546	93283014	+
GWHAAZE00000001	mRNA	93281546	93283014	+
GWHAAZE00000001	exon	93281546	93281561	+
GWHAAZE00000001	exon	93282423	93282789	+
GWHAAZE00000001	exon	93282930	93283014	+
GWHAAZE00000001	CDS	93281546	93281561	+
GWHAAZE00000001	CDS	93282423	93282789	+
GWHAAZE00000001	CDS	93282930	93283014	+

Transcript Sequence
>GWHTAAZE003179 ATGGCTCCGGCTAAAGTTGATAGTTCTAAGAAGGCTGATCCAAAGGCTCAGGCACTGAAGGCTGCCAAAGCTGTAAAATCAGGTTCATCAACCTTCAAGAAGAAAGGTAAGAAGATCCGAACTAAGGTTACTTTTCACAGGCCAAGGACACTGAAGAAGGATAGGAGCCCCAAGTACCCTCGCATCAGTGCTCCTCCCAGAAACAAGTTGGACCACTATCAAATACTCAAATATCCATTGACTACTGAATCTGCAATGAAGAAGATAGAGGATAACAACACGCTTGTCTTCATTGTTGACATCCGTGCTGACAAAAAGAAGATTAAAGATGCAGTGAAGAAAATGTATGACATTCAGACCAAGAAAGTTAACACACTGATCAGGCCTGATGGAACCAAGAAGGCGTACGTTCGGCTTACACCAGATTATGATGCCTTGGATGTGGCAAACAAGATTGGAATTATCTAA

Network for GWHGAAZE003173

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03939.14	Ribosomal_L23eN	15	65	3.90E-18
PF00276.21	Ribosomal_L23	75	136	2.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02893	RP-L23Ae, RPL23A	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	166.486
	SRR3591706	second leaf	62.032
	SRR3591707	mature leaf	25.415
	SRR3591708	Shoot apex	184.638
	SRR3591709	Stem	84.122
	SRR3591710	White floral bud	71.071
	SRR3591711	White flower	68.280
	SRR3591712	Green floral bud	143.192
	SRR3591713	Yellow flower	40.831
SRP173429	SRR8316895	Juvenile bud stage	71.090
	SRR8316896	Juvenile bud stage	110.083
	SRR8316897	Juvenile bud stage	50.536
	SRR8316894	Third green stage	41.805
	SRR8316900	Third green stage	129.906
	SRR8316901	Third green stage	114.417
	SRR8316898	Complete white stage	26.349
	SRR8316899	Complete white stage	109.825
	SRR8316903	Complete white stage	35.979
	SRR8316902	Silver flowering stage	24.522
	SRR8316904	Silver flowering stage	33.366
	SRR8316905	Silver flowering stage	17.275
	SRR8316906	Gold flowering stage	40.058
	SRR8316907	Gold flowering stage	40.586
	SRR8316908	Gold flowering stage	43.060
SRP132670	SRR6706286	Control	113.896
	SRR6706287	Light intensity 50%	117.376
	SRR6706288	Light intensity 20%	135.353
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	130.155
	CNS0095593	Slightly white alabastrum(diploid) 2	124.410
	CNS0095594	Slightly white alabastrum(diploid) 3	123.976
	CNS0095595	Whole white alabastrum(diploid) 2	111.156
	CNS0095596	Whole white alabastrum(diploid) 3	121.525
	CNS0095597	Whole white alabastrum(diploid) 4	88.349
	CNS0095598	Silvery flower (diploied) 1	91.999
	CNS0095599	Silvery flower (diploied) 2	60.559
	CNS0095600	Silvery flower (diploied) 3	52.348
	CNS0095601	Golden flower (diploid) 1	46.996
	CNS0095602	Golden flower (diploid) 2	41.611
	CNS0095603	Golden flower (diploid) 3	40.233
	CNS0095604	Slightly white alabastrum(tetraploid) 1	113.037
	CNS0095605	Slightly white alabastrum(tetraploid) 2	118.011
	CNS0095606	Slightly white alabastrum(tetraploid) 3	115.772
	CNS0095607	Whole white alabastrum(tetraploid) 1	71.200
	CNS0095608	Whole white alabastrum(tetraploid) 2	70.892
	CNS0095609	Whole white alabastrum(tetraploid) 3	104.035
	CNS0095610	Silvery flower (tetraploid) 1	44.155
	CNS0095611	Silvery flower (tetraploid) 2	55.958
	CNS0095612	Silvery flower (tetraploid) 3	32.920
	CNS0095613	Golden flower (tetraploid) 1	30.158
	CNS0095614	Golden flower (tetraploid) 2	34.744
	CNS0095615	Golden flower (tetraploid) 3	27.810
CRA001975	CRR073297	Stem 1	98.925
	CRR073298	Stem 2	98.031
	CRR073299	Stem 3	91.040
	CRR073300	Leaf 1	100.001
	CRR073301	Leaf 2	105.839
	CRR073302	Leaf 3	103.055
	CRR073303	Juvenile bud 1	85.109
	CRR073304	Juvenile bud 2	62.194
	CRR073305	Juvenile bud 3	70.609
	CRR073306	Third green 1	6.445
	CRR073307	Third green 2	7.396
	CRR073308	Third green 3	11.046
	CRR073309	Second white 1	11.706
	CRR073310	Second white 2	13.514
	CRR073311	Second white 3	9.270
	CRR073312	Silver flowering 1	11.250
	CRR073313	Silver flowering 2	17.666
	CRR073314	Silver flowering 3	11.328
	CRR073315	Gold flowering 1	51.401
	CRR073316	Gold flowering 2	55.986
	CRR073317	Gold flowering 3	41.637
	CRR073318	Tawny withering 1	119.025
	CRR073319	Tawny withering 2	123.405
	CRR073320	Tawny withering 3	149.860