Gene detail

Detail information of GWHGAAZE003119

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010658456.1	8.33759E-89	PREDICTED: nuclear transcription factor Y subunit B-1-like isoform X2 [Vitis vinifera]
Swissprot	tr\|Q8VYK4\|NFYB8_ARATH	2E-73	Nuclear transcription factor Y subunit B-8
trEMBL	tr\|D7TMF3\|D7TMF3_VITVI	6E-89	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI31520.3}
TAIR10	AT2G37060.3	2E-58	nuclear factor Y, subunit B8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	92490105	92491927	-
GWHAAZE00000001	mRNA	92490105	92491927	-
GWHAAZE00000001	exon	92490105	92490188	-
GWHAAZE00000001	exon	92490898	92491057	-
GWHAAZE00000001	exon	92491710	92491927	-
GWHAAZE00000001	CDS	92491710	92491927	-
GWHAAZE00000001	CDS	92490898	92491057	-
GWHAAZE00000001	CDS	92490105	92490188	-

Transcript Sequence
>GWHTAAZE003125 ATGGCCGATGCTCCGGCGAGTCCTGCCGGTGGGAGCCACGAGAGTGGCGGGGATCAGAGCCCTAGATCCAACGTTCGCGAGCAGGACCGATACCTACCGATCGCCAACATCAGCCGGATCATGAAAAAGGCGTTACCGGCGAACGGAAAAATCGCCAAGGATGCTAAGGATACTGTTCAGGAATGCGTTTCGGAGTTCATCAGTTTCATCACCAGCGAGGCGAGTGATAAGTGTCAAAAAGAGAAGAGAAAGACGATCAACGGCGATGATTTGCTGTGGGCCATGGCAACATTAGGCTTTGAAGATTACATTGATCCGCTCAAGGCGTACCTAGCTAGGTACAGAGAGGTATTCCTTGATATTTTGAATTTGTATGTGGGCGATACCAAGGGATCTGCTAGGGGTGGTGATGGATCTGCTAGGAAGGAAACAGCTGGGGCTCATCTTGGTCCAAATGCACAG

Network for GWHGAAZE003119

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	31	95	4.40E-28

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	70.601
	SRR3591706	second leaf	33.188
	SRR3591707	mature leaf	27.308
	SRR3591708	Shoot apex	80.698
	SRR3591709	Stem	45.975
	SRR3591710	White floral bud	78.093
	SRR3591711	White flower	45.605
	SRR3591712	Green floral bud	64.286
	SRR3591713	Yellow flower	37.028
SRP173429	SRR8316895	Juvenile bud stage	41.795
	SRR8316896	Juvenile bud stage	51.985
	SRR8316897	Juvenile bud stage	27.170
	SRR8316894	Third green stage	22.612
	SRR8316900	Third green stage	69.567
	SRR8316901	Third green stage	68.983
	SRR8316898	Complete white stage	40.074
	SRR8316899	Complete white stage	93.429
	SRR8316903	Complete white stage	62.335
	SRR8316902	Silver flowering stage	37.071
	SRR8316904	Silver flowering stage	34.227
	SRR8316905	Silver flowering stage	20.696
	SRR8316906	Gold flowering stage	52.978
	SRR8316907	Gold flowering stage	65.300
	SRR8316908	Gold flowering stage	54.977
SRP132670	SRR6706286	Control	97.718
	SRR6706287	Light intensity 50%	98.563
	SRR6706288	Light intensity 20%	103.859
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	52.309
	CNS0095593	Slightly white alabastrum(diploid) 2	59.854
	CNS0095594	Slightly white alabastrum(diploid) 3	45.268
	CNS0095595	Whole white alabastrum(diploid) 2	65.352
	CNS0095596	Whole white alabastrum(diploid) 3	72.541
	CNS0095597	Whole white alabastrum(diploid) 4	73.376
	CNS0095598	Silvery flower (diploied) 1	57.079
	CNS0095599	Silvery flower (diploied) 2	49.575
	CNS0095600	Silvery flower (diploied) 3	48.689
	CNS0095601	Golden flower (diploid) 1	38.065
	CNS0095602	Golden flower (diploid) 2	50.128
	CNS0095603	Golden flower (diploid) 3	53.283
	CNS0095604	Slightly white alabastrum(tetraploid) 1	65.386
	CNS0095605	Slightly white alabastrum(tetraploid) 2	49.700
	CNS0095606	Slightly white alabastrum(tetraploid) 3	77.866
	CNS0095607	Whole white alabastrum(tetraploid) 1	68.988
	CNS0095608	Whole white alabastrum(tetraploid) 2	72.789
	CNS0095609	Whole white alabastrum(tetraploid) 3	66.675
	CNS0095610	Silvery flower (tetraploid) 1	50.058
	CNS0095611	Silvery flower (tetraploid) 2	47.248
	CNS0095612	Silvery flower (tetraploid) 3	48.291
	CNS0095613	Golden flower (tetraploid) 1	35.356
	CNS0095614	Golden flower (tetraploid) 2	38.961
	CNS0095615	Golden flower (tetraploid) 3	26.582
CRA001975	CRR073297	Stem 1	62.973
	CRR073298	Stem 2	51.581
	CRR073299	Stem 3	65.134
	CRR073300	Leaf 1	67.256
	CRR073301	Leaf 2	63.627
	CRR073302	Leaf 3	68.866
	CRR073303	Juvenile bud 1	72.790
	CRR073304	Juvenile bud 2	66.984
	CRR073305	Juvenile bud 3	42.066
	CRR073306	Third green 1	57.042
	CRR073307	Third green 2	51.314
	CRR073308	Third green 3	49.379
	CRR073309	Second white 1	33.370
	CRR073310	Second white 2	25.216
	CRR073311	Second white 3	25.867
	CRR073312	Silver flowering 1	31.438
	CRR073313	Silver flowering 2	30.730
	CRR073314	Silver flowering 3	26.264
	CRR073315	Gold flowering 1	19.887
	CRR073316	Gold flowering 2	21.591
	CRR073317	Gold flowering 3	13.808
	CRR073318	Tawny withering 1	36.493
	CRR073319	Tawny withering 2	37.849
	CRR073320	Tawny withering 3	41.893