Gene detail

Detail information of GWHGAAZE002934

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003634760.1	6.22133E-64	PREDICTED: nuclear transcription factor Y subunit B-3 [Vitis vinifera]
Swissprot	tr\|O23310\|NFYB3_ARATH	7E-62	Nuclear transcription factor Y subunit B-3
trEMBL	tr\|D7UAG5\|D7UAG5_VITVI	2E-64	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI39730.3}
TAIR10	AT4G14540.1	7E-50	nuclear factor Y, subunit B3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	88909968	88910483	-
GWHAAZE00000001	mRNA	88909968	88910483	-
GWHAAZE00000001	exon	88909968	88910483	-
GWHAAZE00000001	CDS	88909968	88910483	-

Transcript Sequence
>GWHTAAZE002938 ATGGCGGATTCCGATGACTCCGGTCACAACAACAACAACGAACTTTCGCAGCAGCAAGAGAAGTTCCTTCCGATAGCGAACGTGAGCCGAATCATGAAGAAGGCTTTGCCGGCGAACGCGAAGATATCGAAGGACGCCAAGGAGACGGTGCAGGAGTGCGTATCGGAGTTCATAAGCTTCGTGACCGGAGAAGCCTCCGACAAGTGCCTGAGGGAGAAGCGAAAGACTATCAACGGCGACGATTTGATCTGGGCCTTGACCACCTTAGGTTTCGATGACTACTTGGAGCCCCTCAAGGTATATCTCCAGAGGTTTAGGGATACTGAGGACGAGAAGAGCGCTATGGCCGCACGGAAGCCCGAATCTACTGGTGCCGATCCTGCCCTAGTCACTGTGGGGAACAAAATAAATAAAAGTGCATTTCCTCTGGGTCAGCACCAGCACCAGCATGCAGGAGCAGGACACGACGACGTTTACGGCCGGCCAAATGCTTGTTATCTGACGACGTTCAAATAG

Network for GWHGAAZE002934

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	22	86	1.60E-26

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.762
	SRR3591706	second leaf	2.745
	SRR3591707	mature leaf	7.551
	SRR3591708	Shoot apex	8.110
	SRR3591709	Stem	43.281
	SRR3591710	White floral bud	6.791
	SRR3591711	White flower	7.163
	SRR3591712	Green floral bud	5.613
	SRR3591713	Yellow flower	3.884
SRP173429	SRR8316895	Juvenile bud stage	6.465
	SRR8316896	Juvenile bud stage	7.911
	SRR8316897	Juvenile bud stage	3.831
	SRR8316894	Third green stage	3.751
	SRR8316900	Third green stage	10.823
	SRR8316901	Third green stage	11.436
	SRR8316898	Complete white stage	7.439
	SRR8316899	Complete white stage	20.925
	SRR8316903	Complete white stage	10.894
	SRR8316902	Silver flowering stage	8.827
	SRR8316904	Silver flowering stage	8.584
	SRR8316905	Silver flowering stage	3.900
	SRR8316906	Gold flowering stage	7.130
	SRR8316907	Gold flowering stage	6.713
	SRR8316908	Gold flowering stage	5.898
SRP132670	SRR6706286	Control	11.446
	SRR6706287	Light intensity 50%	10.668
	SRR6706288	Light intensity 20%	9.640
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.916
	CNS0095593	Slightly white alabastrum(diploid) 2	10.997
	CNS0095594	Slightly white alabastrum(diploid) 3	10.246
	CNS0095595	Whole white alabastrum(diploid) 2	8.243
	CNS0095596	Whole white alabastrum(diploid) 3	7.798
	CNS0095597	Whole white alabastrum(diploid) 4	9.462
	CNS0095598	Silvery flower (diploied) 1	8.809
	CNS0095599	Silvery flower (diploied) 2	11.044
	CNS0095600	Silvery flower (diploied) 3	15.894
	CNS0095601	Golden flower (diploid) 1	10.429
	CNS0095602	Golden flower (diploid) 2	12.806
	CNS0095603	Golden flower (diploid) 3	11.131
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.696
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.097
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.528
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.930
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.525
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.541
	CNS0095610	Silvery flower (tetraploid) 1	10.507
	CNS0095611	Silvery flower (tetraploid) 2	5.181
	CNS0095612	Silvery flower (tetraploid) 3	2.621
	CNS0095613	Golden flower (tetraploid) 1	3.334
	CNS0095614	Golden flower (tetraploid) 2	7.516
	CNS0095615	Golden flower (tetraploid) 3	3.438
CRA001975	CRR073297	Stem 1	6.998
	CRR073298	Stem 2	5.180
	CRR073299	Stem 3	5.381
	CRR073300	Leaf 1	5.035
	CRR073301	Leaf 2	8.917
	CRR073302	Leaf 3	3.584
	CRR073303	Juvenile bud 1	6.364
	CRR073304	Juvenile bud 2	5.825
	CRR073305	Juvenile bud 3	11.118
	CRR073306	Third green 1	15.226
	CRR073307	Third green 2	13.181
	CRR073308	Third green 3	10.551
	CRR073309	Second white 1	10.948
	CRR073310	Second white 2	15.617
	CRR073311	Second white 3	7.968
	CRR073312	Silver flowering 1	8.282
	CRR073313	Silver flowering 2	8.168
	CRR073314	Silver flowering 3	6.924
	CRR073315	Gold flowering 1	2.218
	CRR073316	Gold flowering 2	2.736
	CRR073317	Gold flowering 3	1.153
	CRR073318	Tawny withering 1	6.252
	CRR073319	Tawny withering 2	7.594
	CRR073320	Tawny withering 3	13.855