Gene detail

Detail information of GWHGAAZE002786

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002282795.1	2.7323E-80	PREDICTED: probable histone H2A.2 [Vitis vinifera]
Swissprot	tr\|Q9LD28\|H2A6_ARATH	4E-81	Histone H2A.6
trEMBL	tr\|E0CT43\|E0CT43_VITVI	1E-80	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT4G27230.2	9E-41	histone H2A 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	86214092	86214556	+
GWHAAZE00000001	mRNA	86214092	86214556	+
GWHAAZE00000001	exon	86214092	86214283	+
GWHAAZE00000001	exon	86214368	86214556	+
GWHAAZE00000001	CDS	86214092	86214283	+
GWHAAZE00000001	CDS	86214368	86214556	+

Transcript Sequence
>GWHTAAZE002790 ATGGCAGGAAGAGGCAAAACCCTAGGTGGTGGAGGAGCTGCAAAGAAAGCCACCTCCCGCAGCAGCAAGGCCGGCCTTCAATTCCCCGTCGGTCGTATTGCCCGTTTCCTCAAGGCCGGCAAATACGCAGAGCGTGTCGGCGCCGGAGCCCCCGTCTACCTCGCCGCCGTCCTCGAATATCTCGCCGCGGAGGTGCTTGAATTGGCTGGGAATGCAGCTAGGGATAACAAAAAGACTCGAATTGTGCCTCGACATATTCAATTGGCCGTGAGGAATGACGAGGAACTAAGCAAGCTTCTCGGAGATGTGACTATTGCAAATGGCGGTGTGATGCCAAATATCCACAATCTTTTGCTTCCAAAAAAGGCCGGTGGTTCTTCC

Network for GWHGAAZE002786

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	15	91	2.80E-14
PF16211.6	Histone_H2A_C	94	127	3.60E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	42.949
	SRR3591706	second leaf	24.675
	SRR3591707	mature leaf	20.752
	SRR3591708	Shoot apex	78.452
	SRR3591709	Stem	28.025
	SRR3591710	White floral bud	19.621
	SRR3591711	White flower	11.834
	SRR3591712	Green floral bud	27.632
	SRR3591713	Yellow flower	12.635
SRP173429	SRR8316895	Juvenile bud stage	22.069
	SRR8316896	Juvenile bud stage	26.388
	SRR8316897	Juvenile bud stage	9.408
	SRR8316894	Third green stage	7.019
	SRR8316900	Third green stage	18.893
	SRR8316901	Third green stage	20.178
	SRR8316898	Complete white stage	4.186
	SRR8316899	Complete white stage	25.746
	SRR8316903	Complete white stage	7.561
	SRR8316902	Silver flowering stage	3.582
	SRR8316904	Silver flowering stage	4.494
	SRR8316905	Silver flowering stage	2.500
	SRR8316906	Gold flowering stage	8.283
	SRR8316907	Gold flowering stage	7.636
	SRR8316908	Gold flowering stage	6.623
SRP132670	SRR6706286	Control	17.182
	SRR6706287	Light intensity 50%	17.457
	SRR6706288	Light intensity 20%	19.432
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.592
	CNS0095593	Slightly white alabastrum(diploid) 2	33.881
	CNS0095594	Slightly white alabastrum(diploid) 3	29.978
	CNS0095595	Whole white alabastrum(diploid) 2	21.036
	CNS0095596	Whole white alabastrum(diploid) 3	16.677
	CNS0095597	Whole white alabastrum(diploid) 4	14.110
	CNS0095598	Silvery flower (diploied) 1	16.991
	CNS0095599	Silvery flower (diploied) 2	14.217
	CNS0095600	Silvery flower (diploied) 3	10.460
	CNS0095601	Golden flower (diploid) 1	19.355
	CNS0095602	Golden flower (diploid) 2	13.974
	CNS0095603	Golden flower (diploid) 3	13.946
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.468
	CNS0095605	Slightly white alabastrum(tetraploid) 2	24.261
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.605
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.784
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.096
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.254
	CNS0095610	Silvery flower (tetraploid) 1	12.264
	CNS0095611	Silvery flower (tetraploid) 2	10.040
	CNS0095612	Silvery flower (tetraploid) 3	5.409
	CNS0095613	Golden flower (tetraploid) 1	7.169
	CNS0095614	Golden flower (tetraploid) 2	7.094
	CNS0095615	Golden flower (tetraploid) 3	6.808
CRA001975	CRR073297	Stem 1	26.027
	CRR073298	Stem 2	23.785
	CRR073299	Stem 3	33.710
	CRR073300	Leaf 1	17.068
	CRR073301	Leaf 2	19.785
	CRR073302	Leaf 3	17.480
	CRR073303	Juvenile bud 1	15.555
	CRR073304	Juvenile bud 2	9.479
	CRR073305	Juvenile bud 3	13.532
	CRR073306	Third green 1	2.186
	CRR073307	Third green 2	2.555
	CRR073308	Third green 3	3.114
	CRR073309	Second white 1	5.004
	CRR073310	Second white 2	2.390
	CRR073311	Second white 3	1.122
	CRR073312	Silver flowering 1	1.951
	CRR073313	Silver flowering 2	0.957
	CRR073314	Silver flowering 3	3.707
	CRR073315	Gold flowering 1	25.885
	CRR073316	Gold flowering 2	17.557
	CRR073317	Gold flowering 3	28.076
	CRR073318	Tawny withering 1	21.900
	CRR073319	Tawny withering 2	23.965
	CRR073320	Tawny withering 3	19.338