Gene detail

Detail information of GWHGAAZE002753

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05838.1	1.41893E-37	unnamed protein product [Coffea canephora]
COG	YP_004696643.1	0.000000001	serine/threonine protein kinase
Swissprot	tr\|O81906\|B120_ARATH	1E-32	G-type lectin S-receptor-like serine/threonine-protein kinase B120 (Precursor)
trEMBL	tr\|A0A068UDX9\|A0A068UDX9_COFCA	5E-38	Coffea canephora DH200=94 genomic scaffold, scaffold_19 {ECO:0000313\|EMBL:CDP05838.1}
TAIR10	AT4G21390.1	1E-28	S-locus lectin protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	85659953	85661645	+
GWHAAZE00000001	mRNA	85659953	85661645	+
GWHAAZE00000001	exon	85659953	85660239	+
GWHAAZE00000001	exon	85661278	85661444	+
GWHAAZE00000001	exon	85661524	85661645	+
GWHAAZE00000001	CDS	85659953	85660239	+
GWHAAZE00000001	CDS	85661278	85661278	+
GWHAAZE00000001	three_prime_UTR	85661279	85661444	+
GWHAAZE00000001	three_prime_UTR	85661524	85661645	+

Transcript Sequence
>GWHTAAZE002757 ATGAAAATTGAGACGAACATAGTACTGATCTGGTACAAATGTCATACAGATCAGAACAATAAACATTTGCTGCTGTGGCAGAACCGCTTTGAAATTGCTTTGGGTATTGCAAAGGGACTTCTGTACCTTCACCATGACTCAAGATTAAGAATTATTCATCGGGATCTCAAAGCCAGCAATGTTTTACTTGATAATGAGCTAAACCCCAAAATTTCGGACTTTGGCATTGCAAGAATATTTGGAGGAGATCAAATTGAAGCAAAAACAAAGCGTGTAATTGGAACATAGCCAACTGTGTCAGCAGTGGTTTCGATGTTGGGTAATGAGTGCGTGAAGTTGGGGGAACCTAAAGAGCCGGGATTTTTTATGGAAAGAGATTCCGAAGAAATGGATACTATATCAGGTGAGAAAAGTTACTATTCAGAAAATGCAATAACCATCACAACGCCAGAAGCTCAAAATGTTTGTTCTCTAGACAATTGTATAATGAACTTTTTAACTATTGTGGTGACTATCTTCCGCTGTTGGACCTTTAGTGGTCAAGCGGTGGTGGCTGTGGTCAGCGATGTTTCGTAA

Network for GWHGAAZE002753

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	30	85	1.90E-14

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.382
	SRR3591706	second leaf	1.872
	SRR3591707	mature leaf	7.080
	SRR3591708	Shoot apex	2.354
	SRR3591709	Stem	6.358
	SRR3591710	White floral bud	2.246
	SRR3591711	White flower	2.928
	SRR3591712	Green floral bud	4.821
	SRR3591713	Yellow flower	1.331
SRP173429	SRR8316895	Juvenile bud stage	0.938
	SRR8316896	Juvenile bud stage	2.780
	SRR8316897	Juvenile bud stage	1.207
	SRR8316894	Third green stage	0.897
	SRR8316900	Third green stage	1.080
	SRR8316901	Third green stage	1.277
	SRR8316898	Complete white stage	0.383
	SRR8316899	Complete white stage	1.390
	SRR8316903	Complete white stage	0.369
	SRR8316902	Silver flowering stage	0.206
	SRR8316904	Silver flowering stage	0.587
	SRR8316905	Silver flowering stage	0.048
	SRR8316906	Gold flowering stage	1.021
	SRR8316907	Gold flowering stage	0.083
	SRR8316908	Gold flowering stage	4.109
SRP132670	SRR6706286	Control	0.866
	SRR6706287	Light intensity 50%	0.477
	SRR6706288	Light intensity 20%	0.580
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.313
	CNS0095593	Slightly white alabastrum(diploid) 2	1.988
	CNS0095594	Slightly white alabastrum(diploid) 3	2.107
	CNS0095595	Whole white alabastrum(diploid) 2	1.383
	CNS0095596	Whole white alabastrum(diploid) 3	0.902
	CNS0095597	Whole white alabastrum(diploid) 4	1.142
	CNS0095598	Silvery flower (diploied) 1	0.878
	CNS0095599	Silvery flower (diploied) 2	1.849
	CNS0095600	Silvery flower (diploied) 3	0.283
	CNS0095601	Golden flower (diploid) 1	1.623
	CNS0095602	Golden flower (diploid) 2	0.894
	CNS0095603	Golden flower (diploid) 3	0.981
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.082
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.778
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.462
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.412
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.653
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.627
	CNS0095610	Silvery flower (tetraploid) 1	3.486
	CNS0095611	Silvery flower (tetraploid) 2	3.127
	CNS0095612	Silvery flower (tetraploid) 3	1.944
	CNS0095613	Golden flower (tetraploid) 1	2.786
	CNS0095614	Golden flower (tetraploid) 2	3.312
	CNS0095615	Golden flower (tetraploid) 3	1.926
CRA001975	CRR073297	Stem 1	0.519
	CRR073298	Stem 2	0.373
	CRR073299	Stem 3	0.260
	CRR073300	Leaf 1	0.118
	CRR073301	Leaf 2	0.784
	CRR073302	Leaf 3	0.562
	CRR073303	Juvenile bud 1	0.434
	CRR073304	Juvenile bud 2	0.033
	CRR073305	Juvenile bud 3	0.109
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.119
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.771
	CRR073316	Gold flowering 2	1.813
	CRR073317	Gold flowering 3	0.702
	CRR073318	Tawny withering 1	0.648
	CRR073319	Tawny withering 2	1.295
	CRR073320	Tawny withering 3	0.049