Gene detail

Detail information of GWHGAAZE002679

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009596197.1	5.53839E-22	PREDICTED: serine/threonine-protein kinase 3-like isoform X2 [Nicotiana tomentosiformis]
trEMBL	tr\|K4CGX7\|K4CGX7_SOLLC	2E-22	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc07g062940.2.1}
TAIR10	AT3G15220.1	9E-16	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	84042282	84044986	-
GWHAAZE00000001	mRNA	84042282	84044986	-
GWHAAZE00000001	exon	84044737	84044986	-
GWHAAZE00000001	exon	84043981	84044131	-
GWHAAZE00000001	exon	84042382	84042438	-
GWHAAZE00000001	exon	84042282	84042303	-
GWHAAZE00000001	five_prime_UTR	84044737	84044986	-
GWHAAZE00000001	five_prime_UTR	84044076	84044131	-
GWHAAZE00000001	CDS	84043981	84044075	-
GWHAAZE00000001	CDS	84042382	84042438	-
GWHAAZE00000001	CDS	84042282	84042303	-

Transcript Sequence
>GWHTAAZE002683 TCGAGAGAGATAGCGAAGAGAAGAAATCTCTTCGATGGGGAACTGTGACAGAGAGAAACAAAAGTAGTTGGACAAGGAGATTCAAAATCCATGGCTTTTTAACACAACTAATATAGTAATATTTGATCTGTTTGTTGTAGTATCTCTTTGTCTTCACTCTTACAGAGCCACCATCCACGACAGCCCCTTATTATCACCCCTCTAATTCCATTTCACTGTTACTTTCGAAACCCTAGGATTTTATCCCAAGCCAGCATATTGTATTTGGTTGGTCGAATTTTGTCGGAAAAAGGCTCGTATATAAAGATGGCAGATGCAGCTTCACTTGTGGAGGTGACGGGATCCAGATTTAGTGACCTGGAGCTCATCGGAAGAGGGTCATTCGGAGATGTCTACAAGGCGTTTGACAGTGAGCTTAACAAGGAGGTTGCAATTAAAGTTATTGATTTGGAAGAATCAATTGCTCATTCCATGATTTGA

Network for GWHGAAZE002679

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	STE_STE20-YSK

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.911
	SRR3591706	second leaf	7.275
	SRR3591707	mature leaf	4.436
	SRR3591708	Shoot apex	13.921
	SRR3591709	Stem	29.482
	SRR3591710	White floral bud	12.025
	SRR3591711	White flower	12.585
	SRR3591712	Green floral bud	7.764
	SRR3591713	Yellow flower	13.141
SRP173429	SRR8316895	Juvenile bud stage	10.183
	SRR8316896	Juvenile bud stage	11.731
	SRR8316897	Juvenile bud stage	4.791
	SRR8316894	Third green stage	6.425
	SRR8316900	Third green stage	14.186
	SRR8316901	Third green stage	13.196
	SRR8316898	Complete white stage	8.621
	SRR8316899	Complete white stage	21.338
	SRR8316903	Complete white stage	10.877
	SRR8316902	Silver flowering stage	6.333
	SRR8316904	Silver flowering stage	15.400
	SRR8316905	Silver flowering stage	6.077
	SRR8316906	Gold flowering stage	22.563
	SRR8316907	Gold flowering stage	13.346
	SRR8316908	Gold flowering stage	18.726
SRP132670	SRR6706286	Control	9.811
	SRR6706287	Light intensity 50%	10.560
	SRR6706288	Light intensity 20%	10.855
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.457
	CNS0095593	Slightly white alabastrum(diploid) 2	3.093
	CNS0095594	Slightly white alabastrum(diploid) 3	3.608
	CNS0095595	Whole white alabastrum(diploid) 2	5.790
	CNS0095596	Whole white alabastrum(diploid) 3	5.130
	CNS0095597	Whole white alabastrum(diploid) 4	3.379
	CNS0095598	Silvery flower (diploied) 1	15.138
	CNS0095599	Silvery flower (diploied) 2	11.065
	CNS0095600	Silvery flower (diploied) 3	14.231
	CNS0095601	Golden flower (diploid) 1	7.020
	CNS0095602	Golden flower (diploid) 2	14.138
	CNS0095603	Golden flower (diploid) 3	17.873
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.013
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.907
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.147
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.707
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.983
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.939
	CNS0095610	Silvery flower (tetraploid) 1	20.567
	CNS0095611	Silvery flower (tetraploid) 2	18.936
	CNS0095612	Silvery flower (tetraploid) 3	11.075
	CNS0095613	Golden flower (tetraploid) 1	5.640
	CNS0095614	Golden flower (tetraploid) 2	12.171
	CNS0095615	Golden flower (tetraploid) 3	9.426
CRA001975	CRR073297	Stem 1	10.977
	CRR073298	Stem 2	11.009
	CRR073299	Stem 3	7.509
	CRR073300	Leaf 1	11.630
	CRR073301	Leaf 2	7.611
	CRR073302	Leaf 3	7.119
	CRR073303	Juvenile bud 1	7.763
	CRR073304	Juvenile bud 2	4.470
	CRR073305	Juvenile bud 3	6.077
	CRR073306	Third green 1	1.766
	CRR073307	Third green 2	1.287
	CRR073308	Third green 3	1.671
	CRR073309	Second white 1	1.897
	CRR073310	Second white 2	2.796
	CRR073311	Second white 3	2.612
	CRR073312	Silver flowering 1	0.673
	CRR073313	Silver flowering 2	0.373
	CRR073314	Silver flowering 3	2.303
	CRR073315	Gold flowering 1	3.742
	CRR073316	Gold flowering 2	3.923
	CRR073317	Gold flowering 3	0.945
	CRR073318	Tawny withering 1	7.902
	CRR073319	Tawny withering 2	3.145
	CRR073320	Tawny withering 3	5.524