Gene detail

Detail information of GWHGAAZE002634

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAC83026.1	9.32727E-83	Similar to Ubiquitin-conjugating enzyme E2-17 KD gb\|D83004 from Homo sapiens. ESTs gb\|T88233, gb\|Z24464, gb\|N37265, gb\|H36151, gb\|Z34711, gb\|AA040983, and gb\|T22122 come from this gene [Arabidopsis thaliana]
COG	YP_008797956.1	2E-19	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|Q9FZ48\|UBC36_ARATH	4E-83	Ubiquitin-conjugating enzyme E2 36
trEMBL	tr\|M4ED40\|M4ED40_BRARP	2E-81	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Bra026700.1-P}
TAIR10	AT1G16890.2	9E-66	ubiquitin-conjugating enzyme 36

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	83156655	83159804	+
GWHAAZE00000001	mRNA	83156655	83159804	+
GWHAAZE00000001	exon	83156655	83156739	+
GWHAAZE00000001	exon	83157424	83157482	+
GWHAAZE00000001	exon	83158813	83158854	+
GWHAAZE00000001	exon	83158944	83159017	+
GWHAAZE00000001	exon	83159405	83159507	+
GWHAAZE00000001	exon	83159682	83159804	+
GWHAAZE00000001	CDS	83156655	83156739	+
GWHAAZE00000001	CDS	83157424	83157482	+
GWHAAZE00000001	CDS	83158813	83158854	+
GWHAAZE00000001	CDS	83158944	83159017	+
GWHAAZE00000001	CDS	83159405	83159507	+
GWHAAZE00000001	CDS	83159682	83159804	+

Transcript Sequence
>GWHTAAZE002638 CCGGGAATAAGTGCATCACCGTCTGAAGAAAATATGCGGTACTTTAATGTCATGATTCTTGGTCCATCACAGTCTCCTTATGAAGGTGGAGTTTTCAAGCTAGAACTATTTTTGCCTGAAGAATATCCAATGGCTGCTCCCAAGGTTCGATTTCTCACCAAAATATATCATCCTAACATTGATAAGCTCGGGAGGATATGCCTCGATATTCTAAAAGACAAGTGGAGTCCTGCTCTTCAGATCCGAACCGTACTCTTGAGCATTCAAGCACTATTGAGTGCTCCAAATCCAGATGATCCACTTTCAGAGAACATTGCAAAACACTGGAAAACAAACGAGGCTGAAGCTGTTGAAACTGGTACGCGAAGGAATGGACGCGTCTATATGCCAGTGGAGAGTAGTGAAGCTGTGGACTCCAAGGCGCGCTCCTCAAATAATATAATGTATGCAGTGTATCCTAATATTGAGTGTTGGAAGTTAAATTGA

Network for GWHGAAZE002634

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	2	115	3.30E-45

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10580	UBE2N, BLU, UBC13	Ubiquitin mediated proteolysis	map04120
K10580	UBE2N, BLU, UBC13	Toll and Imd signaling pathway	map04624

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	87.978
	SRR3591706	second leaf	46.862
	SRR3591707	mature leaf	65.586
	SRR3591708	Shoot apex	62.798
	SRR3591709	Stem	138.794
	SRR3591710	White floral bud	146.326
	SRR3591711	White flower	241.256
	SRR3591712	Green floral bud	123.825
	SRR3591713	Yellow flower	216.564
SRP173429	SRR8316895	Juvenile bud stage	64.026
	SRR8316896	Juvenile bud stage	90.728
	SRR8316897	Juvenile bud stage	42.092
	SRR8316894	Third green stage	33.966
	SRR8316900	Third green stage	110.431
	SRR8316901	Third green stage	123.756
	SRR8316898	Complete white stage	83.801
	SRR8316899	Complete white stage	202.886
	SRR8316903	Complete white stage	117.206
	SRR8316902	Silver flowering stage	102.379
	SRR8316904	Silver flowering stage	98.279
	SRR8316905	Silver flowering stage	52.534
	SRR8316906	Gold flowering stage	187.582
	SRR8316907	Gold flowering stage	183.757
	SRR8316908	Gold flowering stage	202.610
SRP132670	SRR6706286	Control	89.892
	SRR6706287	Light intensity 50%	88.746
	SRR6706288	Light intensity 20%	96.599
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	112.483
	CNS0095593	Slightly white alabastrum(diploid) 2	102.059
	CNS0095594	Slightly white alabastrum(diploid) 3	114.683
	CNS0095595	Whole white alabastrum(diploid) 2	96.728
	CNS0095596	Whole white alabastrum(diploid) 3	87.550
	CNS0095597	Whole white alabastrum(diploid) 4	98.790
	CNS0095598	Silvery flower (diploied) 1	127.317
	CNS0095599	Silvery flower (diploied) 2	126.184
	CNS0095600	Silvery flower (diploied) 3	187.110
	CNS0095601	Golden flower (diploid) 1	129.004
	CNS0095602	Golden flower (diploid) 2	173.380
	CNS0095603	Golden flower (diploid) 3	174.970
	CNS0095604	Slightly white alabastrum(tetraploid) 1	96.708
	CNS0095605	Slightly white alabastrum(tetraploid) 2	92.182
	CNS0095606	Slightly white alabastrum(tetraploid) 3	104.256
	CNS0095607	Whole white alabastrum(tetraploid) 1	91.130
	CNS0095608	Whole white alabastrum(tetraploid) 2	95.764
	CNS0095609	Whole white alabastrum(tetraploid) 3	108.261
	CNS0095610	Silvery flower (tetraploid) 1	194.174
	CNS0095611	Silvery flower (tetraploid) 2	192.234
	CNS0095612	Silvery flower (tetraploid) 3	183.797
	CNS0095613	Golden flower (tetraploid) 1	215.865
	CNS0095614	Golden flower (tetraploid) 2	182.829
	CNS0095615	Golden flower (tetraploid) 3	216.758
CRA001975	CRR073297	Stem 1	73.133
	CRR073298	Stem 2	75.078
	CRR073299	Stem 3	91.166
	CRR073300	Leaf 1	71.228
	CRR073301	Leaf 2	87.990
	CRR073302	Leaf 3	86.464
	CRR073303	Juvenile bud 1	93.455
	CRR073304	Juvenile bud 2	86.084
	CRR073305	Juvenile bud 3	101.081
	CRR073306	Third green 1	111.516
	CRR073307	Third green 2	128.125
	CRR073308	Third green 3	106.296
	CRR073309	Second white 1	151.013
	CRR073310	Second white 2	148.713
	CRR073311	Second white 3	113.868
	CRR073312	Silver flowering 1	97.250
	CRR073313	Silver flowering 2	118.665
	CRR073314	Silver flowering 3	89.317
	CRR073315	Gold flowering 1	72.901
	CRR073316	Gold flowering 2	79.716
	CRR073317	Gold flowering 3	89.297
	CRR073318	Tawny withering 1	107.314
	CRR073319	Tawny withering 2	129.265
	CRR073320	Tawny withering 3	112.792