Gene detail

Detail information of GWHGAAZE002630

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001275252.1	1.2382E-124	uncharacterized protein LOC102577837 [Solanum tuberosum]
Swissprot	tr\|Q9ATF5\|RL18A_CASSA	6E-121	60S ribosomal protein L18a
trEMBL	tr\|K4B846\|K4B846_SOLLC	5E-125	60S ribosomal protein L18a {ECO:0000256\|PIRNR:PIRNR002190}
TAIR10	AT2G34480.1	4E-94	Ribosomal protein L18ae/LX family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	83111896	83115779	+
GWHAAZE00000001	mRNA	83111896	83115779	+
GWHAAZE00000001	exon	83111896	83111910	+
GWHAAZE00000001	exon	83112045	83112160	+
GWHAAZE00000001	exon	83112258	83112321	+
GWHAAZE00000001	exon	83115438	83115779	+
GWHAAZE00000001	CDS	83111896	83111910	+
GWHAAZE00000001	CDS	83112045	83112160	+
GWHAAZE00000001	CDS	83112258	83112321	+
GWHAAZE00000001	CDS	83115438	83115779	+

Transcript Sequence
>GWHTAAZE002634 ATGGTGACTTACAGGTTCCATCAGTTCCAGGTTGTGGGAAGAGCTCTCCCAACGGAGACGGATGAGCACCCCAAGATCTACCGCATGAAGCTTTGGGCCACTAATGAAGTCCGTGCCAAGTCCAAATTTTGGTACTTTTTGAGGAAGCTTAAAAAGGTTAAGAAAAGCAATGGCCAGATGCTTGCTATCAATGAGATTTTTGAGAAGAGCCCCACCACCATCAAGAACTACGGTATATGGTTGAGGTACCAGAGTAGAACCGGTTACCACAACATGTACAAGGAGTACCGTGACACGACTTTGAATGGTGCTGTTGAACAGATGTACACTGAGATGGCTTCTCGTCACAGGGTCCGTTCACACTGCATCCAGATCATCAAGACTGCCACCATTCCGGCTAAGCTTTGCAAGAGGGAGAGCACTAAACAGTTCCACAACTCCAAAATCAAGTTCCCGTTGGTCTTCAAGAAGGTAAGGCCGCCAAGTAGGAAGCTCAAGACCACCTACAAGGCCTCTAGGCCTAACTTGTTTGTCTAG

Network for GWHGAAZE002630

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01775.18	Ribosomal_L18A	7	128	9.00E-55

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02882	RP-L18Ae, RPL18A	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	426.645
	SRR3591706	second leaf	199.937
	SRR3591707	mature leaf	82.169
	SRR3591708	Shoot apex	462.853
	SRR3591709	Stem	198.434
	SRR3591710	White floral bud	172.930
	SRR3591711	White flower	240.314
	SRR3591712	Green floral bud	392.165
	SRR3591713	Yellow flower	182.374
SRP173429	SRR8316895	Juvenile bud stage	233.994
	SRR8316896	Juvenile bud stage	330.342
	SRR8316897	Juvenile bud stage	157.569
	SRR8316894	Third green stage	121.815
	SRR8316900	Third green stage	435.121
	SRR8316901	Third green stage	420.989
	SRR8316898	Complete white stage	84.640
	SRR8316899	Complete white stage	387.556
	SRR8316903	Complete white stage	104.940
	SRR8316902	Silver flowering stage	95.421
	SRR8316904	Silver flowering stage	84.229
	SRR8316905	Silver flowering stage	37.504
	SRR8316906	Gold flowering stage	140.198
	SRR8316907	Gold flowering stage	154.768
	SRR8316908	Gold flowering stage	184.159
SRP132670	SRR6706286	Control	495.150
	SRR6706287	Light intensity 50%	484.598
	SRR6706288	Light intensity 20%	525.610
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	355.427
	CNS0095593	Slightly white alabastrum(diploid) 2	428.774
	CNS0095594	Slightly white alabastrum(diploid) 3	339.230
	CNS0095595	Whole white alabastrum(diploid) 2	297.979
	CNS0095596	Whole white alabastrum(diploid) 3	345.538
	CNS0095597	Whole white alabastrum(diploid) 4	239.634
	CNS0095598	Silvery flower (diploied) 1	175.512
	CNS0095599	Silvery flower (diploied) 2	167.064
	CNS0095600	Silvery flower (diploied) 3	135.069
	CNS0095601	Golden flower (diploid) 1	126.637
	CNS0095602	Golden flower (diploid) 2	131.690
	CNS0095603	Golden flower (diploid) 3	128.209
	CNS0095604	Slightly white alabastrum(tetraploid) 1	319.465
	CNS0095605	Slightly white alabastrum(tetraploid) 2	321.003
	CNS0095606	Slightly white alabastrum(tetraploid) 3	396.642
	CNS0095607	Whole white alabastrum(tetraploid) 1	169.088
	CNS0095608	Whole white alabastrum(tetraploid) 2	159.585
	CNS0095609	Whole white alabastrum(tetraploid) 3	302.639
	CNS0095610	Silvery flower (tetraploid) 1	134.105
	CNS0095611	Silvery flower (tetraploid) 2	114.304
	CNS0095612	Silvery flower (tetraploid) 3	83.964
	CNS0095613	Golden flower (tetraploid) 1	95.074
	CNS0095614	Golden flower (tetraploid) 2	115.668
	CNS0095615	Golden flower (tetraploid) 3	81.500
CRA001975	CRR073297	Stem 1	343.732
	CRR073298	Stem 2	343.750
	CRR073299	Stem 3	381.443
	CRR073300	Leaf 1	336.211
	CRR073301	Leaf 2	394.052
	CRR073302	Leaf 3	435.252
	CRR073303	Juvenile bud 1	369.885
	CRR073304	Juvenile bud 2	274.135
	CRR073305	Juvenile bud 3	301.285
	CRR073306	Third green 1	54.707
	CRR073307	Third green 2	52.381
	CRR073308	Third green 3	63.446
	CRR073309	Second white 1	63.897
	CRR073310	Second white 2	56.783
	CRR073311	Second white 3	41.209
	CRR073312	Silver flowering 1	56.737
	CRR073313	Silver flowering 2	77.194
	CRR073314	Silver flowering 3	63.759
	CRR073315	Gold flowering 1	150.269
	CRR073316	Gold flowering 2	149.678
	CRR073317	Gold flowering 3	124.486
	CRR073318	Tawny withering 1	361.911
	CRR073319	Tawny withering 2	275.602
	CRR073320	Tawny withering 3	351.523