Gene detail

Detail information of GWHGAAZE002465

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHC95482.1	4.9045E-121	chlorophyll A/B binding protein [Ziziphus jujuba]
Swissprot	tr\|P12062\|CB26_PETSP	3E-121	Chlorophyll a-b binding protein 37, chloroplastic (Precursor)
trEMBL	tr\|V9VHL7\|V9VHL7_ZIZJJ	2E-121	Chlorophyll A/B binding protein {ECO:0000313\|EMBL:AHC95482.1}
TAIR10	AT3G27690.1	4E-87	photosystem II light harvesting complex gene 2.3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	79270413	79270982	+
GWHAAZE00000001	mRNA	79270413	79270982	+
GWHAAZE00000001	exon	79270413	79270982	+
GWHAAZE00000001	CDS	79270413	79270982	+

Transcript Sequence
>GWHTAAZE002469 ATGGGTGGGACACTGCTGGATTATCAGCCTGACCCAGAGACATTTGTCAAGAACCGTGAGCTTGAGGTGATCCACATCCGATGGGCCATGTTGGGTGCACTCGGTTGTGTCTTCCCTGAACTCCTTGCAAAGAATGGTGTCAAGTTCGGTGAGGCCGTTTGGTTCAAGGCCGGGGCACAAATCTTCTCTGAAGGTGGGCTCGACTATCTTGGAAACCCTAACCTTGTTCATGCTCAGAGCATACTTGCCATCTGGGCCTGCCAAGTTGTGCTCATGGGCTTTGTTGAAGGGTACCGTGTCGGTGGTGGCCCGCTCGGTGAAGGACTCGATATAATTTACCCAGGAGGAGCTTTTGACCCACTTGGACTGGCTGATGATCCTGAGGCATTTGCAGAGTTGAAGGTTAAAGAGCTCAAGAATGGAAGGTTGGCAATGTTTTCAATGTTTGGATTCTTTGTCCAGGCTATTGTTACCGGAAAGGGCCCGATTGAGAATCTCTATGACCATGTTGCTGATCCTGTGGCTAACAATGCGTGGGCTTTTGCCACAAACTTTGCCCCCGGAAAATGA

Network for GWHGAAZE002465

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00504.22	Chloroa_b-bind	11	155	3.00E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08913	LHCB2	Metabolic pathways	map01100
K08913	LHCB2	Photosynthesis - antenna proteins	map00196

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	111.501
	SRR3591706	second leaf	458.439
	SRR3591707	mature leaf	104.115
	SRR3591708	Shoot apex	174.187
	SRR3591709	Stem	33.241
	SRR3591710	White floral bud	0.579
	SRR3591711	White flower	0.896
	SRR3591712	Green floral bud	1.012
	SRR3591713	Yellow flower	0.499
SRP173429	SRR8316895	Juvenile bud stage	21.886
	SRR8316896	Juvenile bud stage	19.428
	SRR8316897	Juvenile bud stage	17.455
	SRR8316894	Third green stage	10.217
	SRR8316900	Third green stage	22.874
	SRR8316901	Third green stage	23.717
	SRR8316898	Complete white stage	7.892
	SRR8316899	Complete white stage	13.065
	SRR8316903	Complete white stage	10.078
	SRR8316902	Silver flowering stage	10.023
	SRR8316904	Silver flowering stage	11.817
	SRR8316905	Silver flowering stage	6.263
	SRR8316906	Gold flowering stage	9.599
	SRR8316907	Gold flowering stage	9.994
	SRR8316908	Gold flowering stage	12.408
SRP132670	SRR6706286	Control	16.789
	SRR6706287	Light intensity 50%	21.829
	SRR6706288	Light intensity 20%	22.513
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	37.817
	CNS0095593	Slightly white alabastrum(diploid) 2	26.303
	CNS0095594	Slightly white alabastrum(diploid) 3	25.091
	CNS0095595	Whole white alabastrum(diploid) 2	16.884
	CNS0095596	Whole white alabastrum(diploid) 3	18.576
	CNS0095597	Whole white alabastrum(diploid) 4	15.032
	CNS0095598	Silvery flower (diploied) 1	37.198
	CNS0095599	Silvery flower (diploied) 2	46.632
	CNS0095600	Silvery flower (diploied) 3	13.717
	CNS0095601	Golden flower (diploid) 1	37.167
	CNS0095602	Golden flower (diploid) 2	13.036
	CNS0095603	Golden flower (diploid) 3	16.291
	CNS0095604	Slightly white alabastrum(tetraploid) 1	34.912
	CNS0095605	Slightly white alabastrum(tetraploid) 2	34.436
	CNS0095606	Slightly white alabastrum(tetraploid) 3	50.720
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.997
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.839
	CNS0095609	Whole white alabastrum(tetraploid) 3	23.724
	CNS0095610	Silvery flower (tetraploid) 1	6.822
	CNS0095611	Silvery flower (tetraploid) 2	11.735
	CNS0095612	Silvery flower (tetraploid) 3	0.650
	CNS0095613	Golden flower (tetraploid) 1	4.564
	CNS0095614	Golden flower (tetraploid) 2	11.817
	CNS0095615	Golden flower (tetraploid) 3	5.381
CRA001975	CRR073297	Stem 1	3.804
	CRR073298	Stem 2	2.421
	CRR073299	Stem 3	5.877
	CRR073300	Leaf 1	2.142
	CRR073301	Leaf 2	3.625
	CRR073302	Leaf 3	1.834
	CRR073303	Juvenile bud 1	2.885
	CRR073304	Juvenile bud 2	2.896
	CRR073305	Juvenile bud 3	1.696
	CRR073306	Third green 1	22.183
	CRR073307	Third green 2	12.473
	CRR073308	Third green 3	13.576
	CRR073309	Second white 1	0.853
	CRR073310	Second white 2	1.282
	CRR073311	Second white 3	0.751
	CRR073312	Silver flowering 1	0.730
	CRR073313	Silver flowering 2	0.653
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	23.908
	CRR073316	Gold flowering 2	18.168
	CRR073317	Gold flowering 3	17.279
	CRR073318	Tawny withering 1	2.248
	CRR073319	Tawny withering 2	0.956
	CRR073320	Tawny withering 3	1.870