Gene detail

Detail information of GWHGAAZE002310

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010247654.1	9.47134E-58	PREDICTED: peptidyl-prolyl cis-trans isomerase CYP22 [Nelumbo nucifera]
COG	NP_441161.1	6E-23	peptidyl-prolyl cis-trans isomerase
Swissprot	tr\|Q9ZVJ4\|CYP22_ARATH	4E-51	Peptidyl-prolyl cis-trans isomerase CYP22
trEMBL	tr\|A5BNQ0\|A5BNQ0_VITVI	4E-58	Peptidyl-prolyl cis-trans isomerase {ECO:0000256\|RuleBase:RU000493}
TAIR10	AT2G38730.1	2E-41	Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	75496019	75500075	+
GWHAAZE00000001	mRNA	75496019	75500075	+
GWHAAZE00000001	exon	75496019	75496182	+
GWHAAZE00000001	exon	75498405	75498428	+
GWHAAZE00000001	exon	75499347	75499434	+
GWHAAZE00000001	exon	75499983	75500075	+
GWHAAZE00000001	CDS	75496019	75496182	+
GWHAAZE00000001	CDS	75498405	75498428	+
GWHAAZE00000001	CDS	75499347	75499434	+
GWHAAZE00000001	CDS	75499983	75500075	+

Transcript Sequence
>GWHTAAZE002314 ATGGCGTCAGGTGGTGGAAATACGGCTGTCGAGTGGCACCAGAGGCCCCCAAACCCTAAAAACCCCATCGTCTTCTTCGACGTCACCATCGGCACCATTCCTGCTGGTCGTATCAAGATGGAACTCTTCGCCGACCTTACCCCCAAAACCGCCGAAAATTTCAGGCAGTTCTGCACGGGCGAGTACAGGAAAGCAGGATTACCGATTGGTTATAAGGGATGCCAGTTCCATAGGGTGATCAAAGATTTTATGATTCAAGCTGGTGATTTTCTGAAGGCATGGGCAGTTCTCCAGAGACATGGGTGGTGTCATGGAACTGGGCATAGGGAATATCCTAGGCATGAGTACCATAAACTTTTAGAGCTGTAG

Network for GWHGAAZE002310

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00160.22	Pro_isomerase	27	93	6.30E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09567	PPIH, CYPH	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0000413	biological_process	protein peptidyl-prolyl isomerization
GO:0006457	biological_process	protein folding
GO:0003755	molecular_function	peptidyl-prolyl cis-trans isomerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	47.306
	SRR3591706	second leaf	35.032
	SRR3591707	mature leaf	34.085
	SRR3591708	Shoot apex	67.395
	SRR3591709	Stem	31.219
	SRR3591710	White floral bud	39.789
	SRR3591711	White flower	47.494
	SRR3591712	Green floral bud	50.781
	SRR3591713	Yellow flower	35.187
SRP173429	SRR8316895	Juvenile bud stage	37.670
	SRR8316896	Juvenile bud stage	53.083
	SRR8316897	Juvenile bud stage	21.977
	SRR8316894	Third green stage	17.398
	SRR8316900	Third green stage	52.485
	SRR8316901	Third green stage	51.168
	SRR8316898	Complete white stage	15.910
	SRR8316899	Complete white stage	51.427
	SRR8316903	Complete white stage	28.641
	SRR8316902	Silver flowering stage	13.448
	SRR8316904	Silver flowering stage	16.714
	SRR8316905	Silver flowering stage	9.061
	SRR8316906	Gold flowering stage	29.553
	SRR8316907	Gold flowering stage	36.572
	SRR8316908	Gold flowering stage	42.079
SRP132670	SRR6706286	Control	69.156
	SRR6706287	Light intensity 50%	71.828
	SRR6706288	Light intensity 20%	76.300
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	42.095
	CNS0095593	Slightly white alabastrum(diploid) 2	40.390
	CNS0095594	Slightly white alabastrum(diploid) 3	52.849
	CNS0095595	Whole white alabastrum(diploid) 2	38.980
	CNS0095596	Whole white alabastrum(diploid) 3	33.753
	CNS0095597	Whole white alabastrum(diploid) 4	28.043
	CNS0095598	Silvery flower (diploied) 1	40.135
	CNS0095599	Silvery flower (diploied) 2	36.253
	CNS0095600	Silvery flower (diploied) 3	38.793
	CNS0095601	Golden flower (diploid) 1	36.946
	CNS0095602	Golden flower (diploid) 2	43.203
	CNS0095603	Golden flower (diploid) 3	40.608
	CNS0095604	Slightly white alabastrum(tetraploid) 1	43.040
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.710
	CNS0095606	Slightly white alabastrum(tetraploid) 3	62.824
	CNS0095607	Whole white alabastrum(tetraploid) 1	31.013
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.838
	CNS0095609	Whole white alabastrum(tetraploid) 3	46.908
	CNS0095610	Silvery flower (tetraploid) 1	30.393
	CNS0095611	Silvery flower (tetraploid) 2	34.272
	CNS0095612	Silvery flower (tetraploid) 3	28.022
	CNS0095613	Golden flower (tetraploid) 1	19.920
	CNS0095614	Golden flower (tetraploid) 2	26.988
	CNS0095615	Golden flower (tetraploid) 3	22.178
CRA001975	CRR073297	Stem 1	44.446
	CRR073298	Stem 2	49.988
	CRR073299	Stem 3	55.669
	CRR073300	Leaf 1	45.831
	CRR073301	Leaf 2	42.853
	CRR073302	Leaf 3	53.251
	CRR073303	Juvenile bud 1	31.303
	CRR073304	Juvenile bud 2	36.505
	CRR073305	Juvenile bud 3	30.498
	CRR073306	Third green 1	10.860
	CRR073307	Third green 2	10.897
	CRR073308	Third green 3	14.083
	CRR073309	Second white 1	13.325
	CRR073310	Second white 2	14.089
	CRR073311	Second white 3	11.343
	CRR073312	Silver flowering 1	7.145
	CRR073313	Silver flowering 2	6.657
	CRR073314	Silver flowering 3	5.285
	CRR073315	Gold flowering 1	25.248
	CRR073316	Gold flowering 2	30.054
	CRR073317	Gold flowering 3	24.218
	CRR073318	Tawny withering 1	38.704
	CRR073319	Tawny withering 2	29.422
	CRR073320	Tawny withering 3	29.490