Gene detail

Detail information of GWHGAAZE002254

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP24725.1	2.98038E-43	hypothetical protein JCGZ_26464 [Jatropha curcas]
Swissprot	tr\|Q7XBH4\|MYB4_ORYSJ	1E-33	Myb-related protein Myb4
trEMBL	tr\|A0A067JXL7\|A0A067JXL7_JATCU	1E-43	Uncharacterized protein {ECO:0000313\|EMBL:KDP24725.1}
TAIR10	AT5G16770.2	7E-29	myb domain protein 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	73764314	73764867	-
GWHAAZE00000001	mRNA	73764314	73764867	-
GWHAAZE00000001	exon	73764314	73764453	-
GWHAAZE00000001	exon	73764735	73764867	-
GWHAAZE00000001	CDS	73764735	73764867	-
GWHAAZE00000001	CDS	73764314	73764453	-

Transcript Sequence
>GWHTAAZE002258 ATGGGGAGAAAATCATGGTATGACAAAAATGGAATGAAGAAAGGGACATGGAGCCAAGAGGAAGATGAAAAGTTGAGATCTTACATTCAAAAATACGGCCATTGGAATTGGATTCAACTTCCTAAATTTGCAGGTTTATCAAGATGTGGAAAAAGTTGCAGGCTCCGATGGTTGAATTATCTTCAACCAAATATTAAAAGGGGAAACTACACAAAAGAAGAAGAGGATCTCATTCTGAAATCACATGAAGAACATGGAAATAAGTATGGATAG

Network for GWHGAAZE002254

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	14	61	1.60E-13
PF00076.23	RRM_1	4	62	4.40E-13
PF00076.23	RRM_1	95	157	1.40E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB-related

KEGG pathway

KO	Enzyme	pathway	mapID
K12893	SFRS4_5_6	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.028
	SRR3591706	second leaf	2.211
	SRR3591707	mature leaf	1.275
	SRR3591708	Shoot apex	0.711
	SRR3591709	Stem	7.832
	SRR3591710	White floral bud	7.912
	SRR3591711	White flower	6.780
	SRR3591712	Green floral bud	1.182
	SRR3591713	Yellow flower	1.281
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	1.212
	SRR8316897	Juvenile bud stage	0.162
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.294
	SRR8316901	Third green stage	0.205
	SRR8316898	Complete white stage	0.243
	SRR8316899	Complete white stage	2.565
	SRR8316903	Complete white stage	0.404
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.126
	SRR8316906	Gold flowering stage	0.768
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.268
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.039
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.161
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.205
	CNS0095596	Whole white alabastrum(diploid) 3	0.133
	CNS0095597	Whole white alabastrum(diploid) 4	0.174
	CNS0095598	Silvery flower (diploied) 1	1.505
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.698
	CNS0095602	Golden flower (diploid) 2	0.604
	CNS0095603	Golden flower (diploid) 3	0.292
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.124
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.501
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.659
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.166
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.249
	CNS0095610	Silvery flower (tetraploid) 1	0.212
	CNS0095611	Silvery flower (tetraploid) 2	0.434
	CNS0095612	Silvery flower (tetraploid) 3	0.073
	CNS0095613	Golden flower (tetraploid) 1	0.254
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.144
	CRR073299	Stem 3	0.143
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.162
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.333
	CRR073305	Juvenile bud 3	0.336
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.434
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	4.376
	CRR073319	Tawny withering 2	9.140
	CRR073320	Tawny withering 3	2.722