Gene detail

Detail information of GWHGAAZE002226

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002306756.1	1.65258E-66	photosystem 2 family protein [Populus trichocarpa]
Swissprot	tr\|Q9LR64\|PB27A_ARATH	2E-65	Photosystem II repair protein PSB27-H1, chloroplastic (Precursor)
trEMBL	tr\|B9H851\|B9H851_POPTR	6E-67	Photosystem 2 family protein {ECO:0000313\|EMBL:EEE93752.1}
TAIR10	AT1G03600.1	2E-49	photosystem II family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	73337610	73337993	-
GWHAAZE00000001	mRNA	73337610	73337993	-
GWHAAZE00000001	exon	73337610	73337993	-
GWHAAZE00000001	CDS	73337610	73337993	-

Transcript Sequence
>GWHTAAZE002230 CACTTCCTCTCCCTCTCCCTCACTGCTTCCGTCCTCCTCCTCCCTGCCACCCCCGCGCGTGCAGCTTCCGAAGAGGAGTACATCAAGGAGACCGAAGGCGTGATCAACAAGGTCCGGTCCACGTTCAAATTGGAGAAGACTGACCCCAATGTGGCCGATGCTGTGGCCGAGCTTAGAGAGTCCTCGAATTCTTGGGTGGCTAAGTACCGGAGAGAGAAGGAACTGCTCGGCCGGTCGTCTTTCCGGGACATTTACTCAGCACTTAACGCCGTCTCCGGCCATTATATTAGTTTCGGACCGACGGCTCCGATTCCGGCAAAGAGGAAGGCCAGGATTTTGGAAGAGATGGATACTGCTGAGAAGGCACTTGTTAGGGGAAGATAA

Network for GWHGAAZE002226

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13326.7	PSII_Pbs27	20	123	1.30E-30
PF08263.13	LRRNT_2	32	74	4.40E-10
PF00069.26	Pkinase	370	633	3.30E-29

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-III

KEGG pathway

KO	Enzyme	pathway	mapID
K08902	psb27	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0010207	biological_process	photosystem II assembly
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.355
	SRR3591706	second leaf	171.543
	SRR3591707	mature leaf	100.362
	SRR3591708	Shoot apex	95.047
	SRR3591709	Stem	12.584
	SRR3591710	White floral bud	36.095
	SRR3591711	White flower	25.663
	SRR3591712	Green floral bud	36.078
	SRR3591713	Yellow flower	13.737
SRP173429	SRR8316895	Juvenile bud stage	30.390
	SRR8316896	Juvenile bud stage	35.307
	SRR8316897	Juvenile bud stage	9.866
	SRR8316894	Third green stage	13.357
	SRR8316900	Third green stage	48.947
	SRR8316901	Third green stage	47.674
	SRR8316898	Complete white stage	19.231
	SRR8316899	Complete white stage	24.306
	SRR8316903	Complete white stage	35.095
	SRR8316902	Silver flowering stage	17.329
	SRR8316904	Silver flowering stage	22.754
	SRR8316905	Silver flowering stage	11.444
	SRR8316906	Gold flowering stage	8.485
	SRR8316907	Gold flowering stage	10.054
	SRR8316908	Gold flowering stage	7.463
SRP132670	SRR6706286	Control	75.473
	SRR6706287	Light intensity 50%	51.495
	SRR6706288	Light intensity 20%	43.049
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	32.850
	CNS0095593	Slightly white alabastrum(diploid) 2	32.996
	CNS0095594	Slightly white alabastrum(diploid) 3	32.245
	CNS0095595	Whole white alabastrum(diploid) 2	25.099
	CNS0095596	Whole white alabastrum(diploid) 3	37.828
	CNS0095597	Whole white alabastrum(diploid) 4	20.945
	CNS0095598	Silvery flower (diploied) 1	82.341
	CNS0095599	Silvery flower (diploied) 2	66.910
	CNS0095600	Silvery flower (diploied) 3	66.279
	CNS0095601	Golden flower (diploid) 1	86.466
	CNS0095602	Golden flower (diploid) 2	63.923
	CNS0095603	Golden flower (diploid) 3	60.898
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.371
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.451
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.708
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.878
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.703
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.541
	CNS0095610	Silvery flower (tetraploid) 1	28.858
	CNS0095611	Silvery flower (tetraploid) 2	21.667
	CNS0095612	Silvery flower (tetraploid) 3	14.023
	CNS0095613	Golden flower (tetraploid) 1	4.245
	CNS0095614	Golden flower (tetraploid) 2	21.298
	CNS0095615	Golden flower (tetraploid) 3	15.702
CRA001975	CRR073297	Stem 1	64.077
	CRR073298	Stem 2	64.726
	CRR073299	Stem 3	86.718
	CRR073300	Leaf 1	22.013
	CRR073301	Leaf 2	30.794
	CRR073302	Leaf 3	33.504
	CRR073303	Juvenile bud 1	35.193
	CRR073304	Juvenile bud 2	23.466
	CRR073305	Juvenile bud 3	42.451
	CRR073306	Third green 1	55.438
	CRR073307	Third green 2	49.431
	CRR073308	Third green 3	58.788
	CRR073309	Second white 1	10.793
	CRR073310	Second white 2	10.244
	CRR073311	Second white 3	5.582
	CRR073312	Silver flowering 1	4.359
	CRR073313	Silver flowering 2	10.358
	CRR073314	Silver flowering 3	3.213
	CRR073315	Gold flowering 1	190.093
	CRR073316	Gold flowering 2	184.125
	CRR073317	Gold flowering 3	248.150
	CRR073318	Tawny withering 1	4.950
	CRR073319	Tawny withering 2	11.725
	CRR073320	Tawny withering 3	10.025