Gene detail

Detail information of GWHGAAZE002217

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002517949.1	7.21096E-65	conserved hypothetical protein [Ricinus communis]
Swissprot	tr\|Q9M0J3\|ERF54_ARATH	1E-54	Ethylene-responsive transcription factor ERF054
trEMBL	tr\|B9RW30\|B9RW30_RICCO	3E-65	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF44467.1}
TAIR10	AT4G28140.1	8E-42	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	73084831	73085592	-
GWHAAZE00000001	mRNA	73084831	73085592	-
GWHAAZE00000001	exon	73085353	73085592	-
GWHAAZE00000001	exon	73085177	73085280	-
GWHAAZE00000001	exon	73084831	73085146	-
GWHAAZE00000001	CDS	73085353	73085592	-
GWHAAZE00000001	CDS	73085177	73085280	-
GWHAAZE00000001	CDS	73084831	73085146	-

Transcript Sequence
>GWHTAAZE002221 ATGGATTGGGAGACCCTTTTTCATGAAGCTTCCGTTTCCGATAACAGACCTCTCAAGAAAATCAAAAGCCCCGAACGCAAAGAAAACTCATATCAACCCTCCTCTGTTTCTTCATTCTCTCAACAAACACACTCTCTTTCTCTCTCCTCCTCTGTTCCAAACAGCCCCACTTTTCCTTCTCCAAGGCTATTTCCTTTTGCTTTCGATGGGTCACAGCCATCCATCGAAAGCCTACGCCAGATGATTTCTTTTGATCCTCTCCACAACCAGCAACAACAAACTTTGCAGTATTGGAGTGATGCATTGAATTTGAGCCCGAGAGGGAGAATGATGATGATCAACCGGCCACCCTTACAACCTTTTACTCCCACAAAGCTCTATAGAGGAGTGAGGCAGAGGCATTGGGGCAAATGGGTAGCCGAAATTCGCCTCCCTCGCAACCGGACCCGCCTTTGGCTCGGCACGTTTGACACTGCCGAAGATGCCGCCATGGCCTACGACCGCGAGGCCTTCAAATTGAGAGGTGAAAACGCAAAGCTGAATTTCCCTGAACGCTTTGTGGGCAAAGAAATGATCGCTTCCACAGCGCCTAGTTCTTCAACTTTTCGCTTCCTAATGAAAGGAATCAAGAAGGGGTTAATGTGCAGGGTCCTAATATAG

Network for GWHGAAZE002217

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	127	176	9.90E-14
PF00069.26	Pkinase	6	103	3.20E-17

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF
Protein Kinases Family	ULK_Fused

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0006468	biological_process	protein phosphorylation
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.520
	SRR3591706	second leaf	0.309
	SRR3591707	mature leaf	1.638
	SRR3591708	Shoot apex	0.126
	SRR3591709	Stem	3.805
	SRR3591710	White floral bud	1.873
	SRR3591711	White flower	5.821
	SRR3591712	Green floral bud	0.357
	SRR3591713	Yellow flower	14.196
SRP173429	SRR8316895	Juvenile bud stage	0.303
	SRR8316896	Juvenile bud stage	0.062
	SRR8316897	Juvenile bud stage	0.208
	SRR8316894	Third green stage	0.026
	SRR8316900	Third green stage	0.368
	SRR8316901	Third green stage	0.519
	SRR8316898	Complete white stage	0.432
	SRR8316899	Complete white stage	1.494
	SRR8316903	Complete white stage	0.314
	SRR8316902	Silver flowering stage	1.640
	SRR8316904	Silver flowering stage	1.798
	SRR8316905	Silver flowering stage	0.928
	SRR8316906	Gold flowering stage	5.744
	SRR8316907	Gold flowering stage	4.981
	SRR8316908	Gold flowering stage	4.487
SRP132670	SRR6706286	Control	0.343
	SRR6706287	Light intensity 50%	0.257
	SRR6706288	Light intensity 20%	0.125
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.016
	CNS0095593	Slightly white alabastrum(diploid) 2	2.505
	CNS0095594	Slightly white alabastrum(diploid) 3	0.359
	CNS0095595	Whole white alabastrum(diploid) 2	0.295
	CNS0095596	Whole white alabastrum(diploid) 3	0.258
	CNS0095597	Whole white alabastrum(diploid) 4	0.658
	CNS0095598	Silvery flower (diploied) 1	2.586
	CNS0095599	Silvery flower (diploied) 2	1.803
	CNS0095600	Silvery flower (diploied) 3	2.600
	CNS0095601	Golden flower (diploid) 1	0.428
	CNS0095602	Golden flower (diploid) 2	1.506
	CNS0095603	Golden flower (diploid) 3	2.242
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.089
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.203
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.081
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.027
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	1.297
	CNS0095611	Silvery flower (tetraploid) 2	0.164
	CNS0095612	Silvery flower (tetraploid) 3	1.062
	CNS0095613	Golden flower (tetraploid) 1	1.554
	CNS0095614	Golden flower (tetraploid) 2	1.095
	CNS0095615	Golden flower (tetraploid) 3	1.534
CRA001975	CRR073297	Stem 1	0.337
	CRR073298	Stem 2	0.603
	CRR073299	Stem 3	0.055
	CRR073300	Leaf 1	1.038
	CRR073301	Leaf 2	2.074
	CRR073302	Leaf 3	0.844
	CRR073303	Juvenile bud 1	1.107
	CRR073304	Juvenile bud 2	1.430
	CRR073305	Juvenile bud 3	1.479
	CRR073306	Third green 1	1.740
	CRR073307	Third green 2	1.368
	CRR073308	Third green 3	2.369
	CRR073309	Second white 1	2.487
	CRR073310	Second white 2	1.839
	CRR073311	Second white 3	2.230
	CRR073312	Silver flowering 1	13.187
	CRR073313	Silver flowering 2	13.947
	CRR073314	Silver flowering 3	17.010
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.051
	CRR073317	Gold flowering 3	0.036
	CRR073318	Tawny withering 1	2.819
	CRR073319	Tawny withering 2	3.383
	CRR073320	Tawny withering 3	1.698