Gene detail

Detail information of GWHGAAZE002194

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010464106.1	8.77984E-06	PREDICTED: uncharacterized protein LOC104744713 [Camelina sativa]
TAIR10	AT1G50690.1	0.005	Cystatin/monellin superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	72547918	72549672	-
GWHAAZE00000001	mRNA	72547918	72549672	-
GWHAAZE00000001	exon	72547918	72548118	-
GWHAAZE00000001	exon	72549087	72549212	-
GWHAAZE00000001	exon	72549358	72549672	-
GWHAAZE00000001	CDS	72549358	72549672	-
GWHAAZE00000001	CDS	72549087	72549212	-
GWHAAZE00000001	CDS	72547918	72548118	-

Transcript Sequence
>GWHTAAZE002198 ATGGCTTCCGAATCACAACCAGAAAAGAAGAAACAAAAATTTGATGAAGAAGTGGAAAAGGTCTCTCTTCTTGATCCTACCAGAGGAGGAGATGATGGCAAAACAGAGGAAGAGACACCTAATGACGATAATGTTGAAGATGCAGAAGAAGAGGAATATGATGGTGATGATGATGATGTAGATGAAGTGGAATATATTGCTGATGATGATGAAGACTTGGATAAACCTATACCACACATTCCCTATTATAGTAGTGAAGAGGACTGTGATAGTGAGGAATACAAGGAATACCGTCGAATTATCAACGAGAGCAAGGGTTTCACGGTTCCACCAAGGCCCAAAGGTGTAAGAATTGCAGCTACTGGTCCTGTTCAAGTTGTAAACCCTGAGTGCCTGGATAAGTTTGCAAAGTATGCACTTGTTTGGTATAAGAAAACATATAAAGAGGACACGGAAAACTACGAGCTCTTGAGGGTGGATAGGGCAAATGCTATGCCTGATCGTGGCATATTATATTATATTACCTTTGTGGCCCGTGCTGTTGGTGCTAGTTGTGATGTAACATTTCAAGCTAAGGTGCTGAATGGGCTCAATTATACTCATGAAGTCGACTCCTGTGAGATTGTTCCAAATGGTTCTTAG

Network for GWHGAAZE002194

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00503.21	G-alpha	31	361	1.50E-79

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19729	GNAT3	Carbohydrate digestion and absorption	map04973
K19729	GNAT3	Taste transduction	map04742

Gene Ontology

GO term	Ontology	Name
GO:0007165	biological_process	signal transduction
GO:0007186	biological_process	G protein-coupled receptor signaling pathway
GO:0007188	biological_process	adenylate cyclase-modulating G protein-coupled receptor signaling pathway
GO:0005834	cellular_component	heterotrimeric G-protein complex
GO:0003924	molecular_function	GTPase activity
GO:0019001	molecular_function	guanyl nucleotide binding
GO:0031683	molecular_function	G-protein beta/gamma-subunit complex binding
GO:0001664	molecular_function	G protein-coupled receptor binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.463
	SRR3591706	second leaf	1.268
	SRR3591707	mature leaf	1.674
	SRR3591708	Shoot apex	2.608
	SRR3591709	Stem	4.634
	SRR3591710	White floral bud	0.168
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.165
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	6.079
	SRR8316896	Juvenile bud stage	10.169
	SRR8316897	Juvenile bud stage	2.939
	SRR8316894	Third green stage	1.915
	SRR8316900	Third green stage	6.724
	SRR8316901	Third green stage	6.567
	SRR8316898	Complete white stage	1.922
	SRR8316899	Complete white stage	7.220
	SRR8316903	Complete white stage	3.229
	SRR8316902	Silver flowering stage	1.995
	SRR8316904	Silver flowering stage	1.657
	SRR8316905	Silver flowering stage	1.035
	SRR8316906	Gold flowering stage	4.400
	SRR8316907	Gold flowering stage	6.244
	SRR8316908	Gold flowering stage	2.595
SRP132670	SRR6706286	Control	3.366
	SRR6706287	Light intensity 50%	4.072
	SRR6706288	Light intensity 20%	3.888
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.198
	CNS0095593	Slightly white alabastrum(diploid) 2	3.908
	CNS0095594	Slightly white alabastrum(diploid) 3	8.669
	CNS0095595	Whole white alabastrum(diploid) 2	8.112
	CNS0095596	Whole white alabastrum(diploid) 3	10.617
	CNS0095597	Whole white alabastrum(diploid) 4	9.161
	CNS0095598	Silvery flower (diploied) 1	6.900
	CNS0095599	Silvery flower (diploied) 2	5.416
	CNS0095600	Silvery flower (diploied) 3	3.459
	CNS0095601	Golden flower (diploid) 1	6.275
	CNS0095602	Golden flower (diploid) 2	2.925
	CNS0095603	Golden flower (diploid) 3	4.142
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.870
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.931
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.551
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.056
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.852
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.485
	CNS0095610	Silvery flower (tetraploid) 1	3.097
	CNS0095611	Silvery flower (tetraploid) 2	2.670
	CNS0095612	Silvery flower (tetraploid) 3	3.871
	CNS0095613	Golden flower (tetraploid) 1	1.726
	CNS0095614	Golden flower (tetraploid) 2	3.677
	CNS0095615	Golden flower (tetraploid) 3	0.966
CRA001975	CRR073297	Stem 1	2.119
	CRR073298	Stem 2	1.915
	CRR073299	Stem 3	0.634
	CRR073300	Leaf 1	2.636
	CRR073301	Leaf 2	2.474
	CRR073302	Leaf 3	2.319
	CRR073303	Juvenile bud 1	0.491
	CRR073304	Juvenile bud 2	1.226
	CRR073305	Juvenile bud 3	0.995
	CRR073306	Third green 1	0.495
	CRR073307	Third green 2	0.436
	CRR073308	Third green 3	0.142
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.527
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.123
	CRR073313	Silver flowering 2	0.744
	CRR073314	Silver flowering 3	0.003
	CRR073315	Gold flowering 1	0.921
	CRR073316	Gold flowering 2	1.941
	CRR073317	Gold flowering 3	0.540
	CRR073318	Tawny withering 1	1.357
	CRR073319	Tawny withering 2	2.623
	CRR073320	Tawny withering 3	2.088