Gene detail

Detail information of GWHGAAZE002159

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002512705.1	7.31402E-46	conserved hypothetical protein [Ricinus communis]
Swissprot	tr\|Q9SD53\|Y3720_ARATH	2E-17	UPF0481 protein At3g47200
trEMBL	tr\|B9RG36\|B9RG36_RICCO	3E-46	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF50157.1}
TAIR10	AT3G50150.1	2E-20	Plant protein of unknown function (DUF247)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	71355195	71355644	+
GWHAAZE00000001	mRNA	71355195	71355644	+
GWHAAZE00000001	exon	71355195	71355644	+
GWHAAZE00000001	CDS	71355195	71355644	+

Transcript Sequence
>GWHTAAZE002163 ATGGAGGCGGAGGTACGCGAGAAGAGGTGCATCTTCAAAGTGGCTCCTCTTGTTAAAGAACTAAACGAGAAAGCATACAAGCCACAAGTAGTCTCCATTGGGCCTTACCATCACGGTGAGGAACATTTAAAACCTATGGAGCAGCACAAGCATCGAGCTCTTCTTCACTTTCTCAAGAGATCTGACAAACCTTTCCTGTCTTACGTCCAATCTTTGTTTGGAGTTGTACAATATTTGAGGGACTCGTACGATCTTCTTGATCCCGTATGGATACAAGATACAGACGCGTTCTTAAAACTGATGGTTCTTGACGGATGCTTTACAATTGAAATAGTGCGTGCAATGAAGCGTGCGGCCACTTATGCCAAGAATGACTATGCTTTTTCTTCAAGTGCGATATGCTCATGCTTGAAAACCAACTCCCTATCTTGGTCCACCAAAAACTCTTAG

Network for GWHGAAZE002159

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03140.16	DUF247	11	130	2.70E-29
PF07714.18	PK_Tyr_Ser-Thr	29	286	1.90E-57

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	TKL-Pl-4

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.361
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.571
	SRR8316896	Juvenile bud stage	0.287
	SRR8316897	Juvenile bud stage	0.706
	SRR8316894	Third green stage	0.221
	SRR8316900	Third green stage	0.115
	SRR8316901	Third green stage	1.100
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.115
	SRR8316903	Complete white stage	0.016
	SRR8316902	Silver flowering stage	0.231
	SRR8316904	Silver flowering stage	0.076
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.122
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.383
	SRR6706287	Light intensity 50%	0.656
	SRR6706288	Light intensity 20%	0.348
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.128
	CNS0095593	Slightly white alabastrum(diploid) 2	0.418
	CNS0095594	Slightly white alabastrum(diploid) 3	0.280
	CNS0095595	Whole white alabastrum(diploid) 2	0.289
	CNS0095596	Whole white alabastrum(diploid) 3	0.122
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.251
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.042
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.904
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.372
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.747
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.182
	CNS0095610	Silvery flower (tetraploid) 1	0.080
	CNS0095611	Silvery flower (tetraploid) 2	0.089
	CNS0095612	Silvery flower (tetraploid) 3	0.143
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.744
	CRR073298	Stem 2	0.222
	CRR073299	Stem 3	0.029
	CRR073300	Leaf 1	0.312
	CRR073301	Leaf 2	0.534
	CRR073302	Leaf 3	0.619
	CRR073303	Juvenile bud 1	0.740
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.255
	CRR073307	Third green 2	0.179
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.504
	CRR073314	Silver flowering 3	0.450
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	3.339
	CRR073319	Tawny withering 2	1.303
	CRR073320	Tawny withering 3	1.439