Gene detail

Detail information of GWHGAAZE002156

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010656994.1	1.69635E-27	PREDICTED: squamosa promoter-binding protein 1 isoform X1 [Vitis vinifera]
Swissprot	tr\|Q38741\|SBP1_ANTMA	2E-22	Squamosa promoter-binding protein 1
trEMBL	tr\|E0CTG4\|E0CTG4_VITVI	2E-27	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI21879.3}
TAIR10	AT2G33810.1	1E-16	squamosa promoter binding protein-like 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	71280425	71281684	-
GWHAAZE00000001	mRNA	71280425	71281684	-
GWHAAZE00000001	exon	71281377	71281684	-
GWHAAZE00000001	exon	71280425	71280545	-
GWHAAZE00000001	five_prime_UTR	71281670	71281684	-
GWHAAZE00000001	CDS	71281377	71281669	-
GWHAAZE00000001	CDS	71280425	71280545	-

Transcript Sequence
>GWHTAAZE002160 AACTATCTTGATCCAATGGAAAGTATTTTAGCCAATAGGGCCGGGCAGAAGCAGAAGGTGGTGGCTGAAAAGCCCGAAATGGAGGATGAAGAGAAGAAGCGAGGCAGCAGTGGCGGAGACAAGAAAGGGTTGAGTAATGGTGGGGGATCCGGGAGTTCAATGAAGTGTTGCCAGGCGGAGAATTGTACGGTTGATCTGAGTGATGCGAAGCAGTACCATAAGCGGCATAAGGTGTGCGAGCTCCATGCCAAAGCTCCGGTGGTGGTGGTCGCTGGAATCCTCCAGCGGTTCTGTCAGCAATGCAGCAGCCTCTACGATAAGCAAGTGAATGGGACATGCCTGTCACTTAAAGAAGCAAGTGACTCTCGCGGGTATCTATCAACATATAGAGATGTCGCTCCGTGCGATAATAGCCCGTCACTCACCTAA

Network for GWHGAAZE002156

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03110.15	SBP	52	99	3.50E-18
PF04321.18	RmlD_sub_bind	15	188	9.30E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SBP

KEGG pathway

KO	Enzyme	pathway	mapID
K12451	UER1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Amino sugar and nucleotide sugar metabolism	map00520
		Polyketide sugar unit biosynthesis	map00523

Gene Ontology

GO term	Ontology	Name
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.293
	SRR3591706	second leaf	1.706
	SRR3591707	mature leaf	11.932
	SRR3591708	Shoot apex	1.465
	SRR3591709	Stem	0.690
	SRR3591710	White floral bud	22.627
	SRR3591711	White flower	11.299
	SRR3591712	Green floral bud	60.298
	SRR3591713	Yellow flower	0.453
SRP173429	SRR8316895	Juvenile bud stage	13.467
	SRR8316896	Juvenile bud stage	5.240
	SRR8316897	Juvenile bud stage	10.160
	SRR8316894	Third green stage	7.166
	SRR8316900	Third green stage	50.641
	SRR8316901	Third green stage	33.741
	SRR8316898	Complete white stage	2.355
	SRR8316899	Complete white stage	58.165
	SRR8316903	Complete white stage	4.935
	SRR8316902	Silver flowering stage	0.171
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	59.552
	SRR6706287	Light intensity 50%	44.308
	SRR6706288	Light intensity 20%	42.051
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.075
	CNS0095593	Slightly white alabastrum(diploid) 2	21.932
	CNS0095594	Slightly white alabastrum(diploid) 3	6.198
	CNS0095595	Whole white alabastrum(diploid) 2	29.464
	CNS0095596	Whole white alabastrum(diploid) 3	41.605
	CNS0095597	Whole white alabastrum(diploid) 4	21.556
	CNS0095598	Silvery flower (diploied) 1	31.232
	CNS0095599	Silvery flower (diploied) 2	30.945
	CNS0095600	Silvery flower (diploied) 3	7.235
	CNS0095601	Golden flower (diploid) 1	28.074
	CNS0095602	Golden flower (diploid) 2	14.889
	CNS0095603	Golden flower (diploid) 3	12.913
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.842
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.554
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.607
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.717
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.377
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.842
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	10.657
	CNS0095612	Silvery flower (tetraploid) 3	3.054
	CNS0095613	Golden flower (tetraploid) 1	0.049
	CNS0095614	Golden flower (tetraploid) 2	0.254
	CNS0095615	Golden flower (tetraploid) 3	0.071
CRA001975	CRR073297	Stem 1	22.127
	CRR073298	Stem 2	23.355
	CRR073299	Stem 3	19.060
	CRR073300	Leaf 1	36.364
	CRR073301	Leaf 2	41.433
	CRR073302	Leaf 3	44.184
	CRR073303	Juvenile bud 1	54.022
	CRR073304	Juvenile bud 2	26.737
	CRR073305	Juvenile bud 3	64.230
	CRR073306	Third green 1	0.348
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.270
	CRR073309	Second white 1	0.133
	CRR073310	Second white 2	0.146
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.179
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	8.072
	CRR073316	Gold flowering 2	11.153
	CRR073317	Gold flowering 3	3.773
	CRR073318	Tawny withering 1	0.541
	CRR073319	Tawny withering 2	1.012
	CRR073320	Tawny withering 3	1.590