Gene detail

Detail information of GWHGAAZE002148

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002278190.1	1.25709E-75	PREDICTED: trans-resveratrol di-O-methyltransferase [Vitis vinifera]
COG	YP_006806764.1	2E-10	O-demethylpuromycin-O-methyltransferase
Swissprot	tr\|B6VJS4\|ROMT_VITVI	1E-66	Trans-resveratrol di-O-methyltransferase
trEMBL	tr\|F6H5H5\|F6H5H5_VITVI	5E-76	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB47327.1}
TAIR10	AT4G35160.1	3E-20	O-methyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	71163089	71163667	+
GWHAAZE00000001	mRNA	71163089	71163667	+
GWHAAZE00000001	exon	71163089	71163667	+
GWHAAZE00000001	CDS	71163089	71163667	+

Transcript Sequence
>GWHTAAZE002152 ATGTCCCTCAATTGTGCTATCAAACTAGGCATACCGGATGCCATCAACAACCACGGCCATCCGATGACACTCTCGGACCTCATCGACACTCTCTCGATCAACAAAAAGAAATCCGACGGTATCCACCGCCTCATGCGCATGTTAGTCCACTCCGGGTTCTTTGTTGAAAAAGATACCCCAGAAAACGGAAAAGAAGTGGGGTACTGGCTTACACCAGCTTCACGATTGTTCCTAAAGGACGAACCATTATGCCTTACACCGTTTTTACAACTTATGTTGGACCCAGTTATTAAAAAACCGTGGCACTATATGAGTGAGTGGTTCCAAAATGAGGATCGCACGCCGTTTGAGACCGCCCATGGGATGACCATTTGGGAGTATGCGGGCAACAGGTCAAAATTTAATAATTTGTTCAATGTTGCGATGGCTAGTGATGCAAGGTTGATAGCAAGCGTCGTTGTTAAGGATTGTGGTGTGATTTTCGAGGGTTTGGAGTCTGTTGTAGATGTTGGTGGTGGGACCGGAACGTCGATGAGGGCTGACCGCGGCGTTCCCGCAGTTGAAGTGCACGGTGCTTGA

Network for GWHGAAZE002148

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08100.12	Dimerisation	1	49	6.20E-15
PF00891.19	Methyltransf_2	101	179	5.70E-14
PF04810.16	zf-Sec23_Sec24	57	95	2.90E-15
PF04811.16	Sec23_trunk	134	402	2.20E-70
PF08033.13	Sec23_BS	413	516	3.50E-30
PF04815.16	Sec23_helical	531	628	1.70E-23
PF00626.23	Gelsolin	643	728	3.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16040	ROMT	Stilbenoid, diarylheptanoid and gingerol biosynthesis	map00945
K16040	ROMT	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0090114	biological_process	COPII-coated vesicle budding
GO:0006886	biological_process	intracellular protein transport
GO:0006888	biological_process	endoplasmic reticulum to Golgi vesicle-mediated transport
GO:0030127	cellular_component	COPII vesicle coat
GO:0008270	molecular_function	zinc ion binding
GO:0046983	molecular_function	protein dimerization activity
GO:0008168	molecular_function	methyltransferase activity
GO:0008171	molecular_function	O-methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.434
	SRR3591706	second leaf	15.339
	SRR3591707	mature leaf	1.982
	SRR3591708	Shoot apex	9.947
	SRR3591709	Stem	5.474
	SRR3591710	White floral bud	2.883
	SRR3591711	White flower	1.298
	SRR3591712	Green floral bud	3.412
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.587
	SRR8316896	Juvenile bud stage	2.181
	SRR8316897	Juvenile bud stage	3.035
	SRR8316894	Third green stage	1.623
	SRR8316900	Third green stage	2.343
	SRR8316901	Third green stage	3.308
	SRR8316898	Complete white stage	0.774
	SRR8316899	Complete white stage	7.040
	SRR8316903	Complete white stage	0.675
	SRR8316902	Silver flowering stage	0.196
	SRR8316904	Silver flowering stage	0.372
	SRR8316905	Silver flowering stage	0.097
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.072
SRP132670	SRR6706286	Control	4.462
	SRR6706287	Light intensity 50%	2.433
	SRR6706288	Light intensity 20%	2.557
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.301
	CNS0095593	Slightly white alabastrum(diploid) 2	1.817
	CNS0095594	Slightly white alabastrum(diploid) 3	0.352
	CNS0095595	Whole white alabastrum(diploid) 2	0.457
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.170
	CNS0095598	Silvery flower (diploied) 1	2.119
	CNS0095599	Silvery flower (diploied) 2	0.990
	CNS0095600	Silvery flower (diploied) 3	0.963
	CNS0095601	Golden flower (diploid) 1	0.695
	CNS0095602	Golden flower (diploid) 2	0.106
	CNS0095603	Golden flower (diploid) 3	0.264
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.171
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.236
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.500
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.532
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.217
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.158
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.118
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.485
	CRR073298	Stem 2	1.578
	CRR073299	Stem 3	3.630
	CRR073300	Leaf 1	5.626
	CRR073301	Leaf 2	8.659
	CRR073302	Leaf 3	1.837
	CRR073303	Juvenile bud 1	0.604
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	2.363
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.052
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.765
	CRR073316	Gold flowering 2	1.814
	CRR073317	Gold flowering 3	0.491
	CRR073318	Tawny withering 1	0.095
	CRR073319	Tawny withering 2	0.591
	CRR073320	Tawny withering 3	1.165