Gene detail

Detail information of GWHGAAZE002145

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN73270.1	1.14129E-85	hypothetical protein VITISV_021918 [Vitis vinifera]
COG	YP_001536889.1	0.000003	O-methyltransferase family protein
Swissprot	tr\|Q93WU3\|CVMT1_OCIBA	6E-74	Chavicol O-methyltransferase
trEMBL	tr\|A5CBK2\|A5CBK2_VITVI	4E-86	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN73270.1}
TAIR10	AT4G35150.1	1E-22	O-methyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	71131138	71131916	+
GWHAAZE00000001	mRNA	71131138	71131916	+
GWHAAZE00000001	exon	71131138	71131537	+
GWHAAZE00000001	exon	71131675	71131916	+
GWHAAZE00000001	CDS	71131138	71131537	+
GWHAAZE00000001	CDS	71131675	71131916	+

Transcript Sequence
>GWHTAAZE002149 ATGGAAATGACAAATAGTGAGCAAACTGGTGAGCTACTTCAGGCTCATGCTCATATATGGAACCATATACTAAAATTCATAAATACAATGTCCCTCAATTGTGCTATCAAACTAGGCATACCGGATGCCATCAACAACCACGGCCATCCGATGACGCTCTCGGACCTCATCAACACTCTCCCGATCAACAAAAAGAAATCCGATGGTATCCACCGCCTCATGCGCATGTTAGTCCACTCCGAGTTCTTCGTTGAAAAAGAAACCCCAGAAAACGGAAAAGAAGTGGGGTACTGGCTTACACCAGCTTCACGATTGTTCCTAAAGGACGAACCATTATGCGTTACACCGTTTTTACAACTTATGCTGGACCCAGTTATTAAAAAACCGTGGCACTATATGGCAAGCGTCGTTGTTAAGGATTGTGGTGTGATTTTTGAGGGTTTGGAATCTGTTGTAGATGTGGGTGGTGGGACCGGGACGTTGATGAGGGCGGTGACCACGGCGTTCCCGCAGTTGAAATGCACGGTGCTTGATCTTCCACAAGTGGTGGGGGATTTGGTTGGGAGTGAAAATTTGAGGTTTGTTGGTGGGGATATGTTTCAGGCTATTCCTCCTGCAAATGCTGTTTTACTCGAGGAATGA

Network for GWHGAAZE002145

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08100.12	Dimerisation	30	78	1.00E-15
PF00891.19	Methyltransf_2	126	212	3.80E-18
PF00069.26	Pkinase	3	231	1.20E-34

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-II

KEGG pathway

KO	Enzyme	pathway	mapID
K13416	BAK1	MAPK signaling pathway - plant	map04016
		Plant hormone signal transduction	map04075
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0008168	molecular_function	methyltransferase activity
GO:0046983	molecular_function	protein dimerization activity
GO:0008171	molecular_function	O-methyltransferase activity
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.893
	SRR3591706	second leaf	1.033
	SRR3591707	mature leaf	0.592
	SRR3591708	Shoot apex	1.304
	SRR3591709	Stem	0.079
	SRR3591710	White floral bud	0.238
	SRR3591711	White flower	0.526
	SRR3591712	Green floral bud	0.227
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.130
	SRR8316896	Juvenile bud stage	0.091
	SRR8316897	Juvenile bud stage	0.084
	SRR8316894	Third green stage	0.357
	SRR8316900	Third green stage	0.132
	SRR8316901	Third green stage	0.465
	SRR8316898	Complete white stage	0.345
	SRR8316899	Complete white stage	0.402
	SRR8316903	Complete white stage	0.133
	SRR8316902	Silver flowering stage	0.114
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.072
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.047
SRP132670	SRR6706286	Control	0.263
	SRR6706287	Light intensity 50%	0.063
	SRR6706288	Light intensity 20%	0.059
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.217
	CNS0095593	Slightly white alabastrum(diploid) 2	0.045
	CNS0095594	Slightly white alabastrum(diploid) 3	0.038
	CNS0095595	Whole white alabastrum(diploid) 2	0.033
	CNS0095596	Whole white alabastrum(diploid) 3	0.069
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.346
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.057
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.266
	CNS0095603	Golden flower (diploid) 3	0.033
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.392
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.941
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.136
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.127
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.054
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.415
	CRR073298	Stem 2	0.726
	CRR073299	Stem 3	0.105
	CRR073300	Leaf 1	0.156
	CRR073301	Leaf 2	0.592
	CRR073302	Leaf 3	0.054
	CRR073303	Juvenile bud 1	0.005
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.163
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.946
	CRR073316	Gold flowering 2	0.159
	CRR073317	Gold flowering 3	0.234
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.066
	CRR073320	Tawny withering 3	0.000