Gene detail

Detail information of GWHGAAZE002138

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004303142.1	4.1583E-120	PREDICTED: protein-lysine methyltransferase METTL21B-like [Fragaria vesca subsp. vesca]
trEMBL	tr\|K4CFQ3\|K4CFQ3_SOLLC	4E-120	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc07g053580.1.1}
TAIR10	AT5G44170.1	9E-79	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	70911814	70913443	+
GWHAAZE00000001	mRNA	70911814	70913443	+
GWHAAZE00000001	exon	70911814	70912336	+
GWHAAZE00000001	exon	70913156	70913329	+
GWHAAZE00000001	exon	70913427	70913443	+
GWHAAZE00000001	CDS	70911814	70912336	+
GWHAAZE00000001	CDS	70913156	70913329	+
GWHAAZE00000001	CDS	70913427	70913443	+

Transcript Sequence
>GWHTAAZE002142 ATGAAATTCACAGACTCGCCGGTAATCGACCTTGCCGTCGGCGCATCCCACCTCTCCTTCCAACAAGACAACGGCTCGATGCATGTCGGCACCACCGTCTGGCCCTGCTCCCTCATCCTCGTCAAATTCGCCGAGCGCTGGACAACCCTAACCCCCTCCGACCCCACCTCGAACCCCTACGCCGAAGTCCTCGATTTCCACAACAAGCGCGCAATCGAGCTCGGCACGGGCTGCGGCGTGGCCGCCATGGGCCTCTACCTCCTCGGCCTCACCGATATCATCCTCACCGACATCGCTCCGGTCATGCCGGCCCTGAAGAAGAATCTGAAGAGGAATAAGAATGTTTTGGGGCGGATGTTGAAGAGTGCTCAGCTTTATTGGAATAATGAGGACCAGATCAAAGCCCTAGGGGCTAAATATGACATTGTAATTGCTACGGATGTTGTGTATATTGAGGAGACTGTGGGGCCTTTGGTTAAGGCCATGGAGGCGCTGGTGAAGGATGATGGAGTTGTGTTGCTAGGGTACCAATTGAGGTCACCGGAGGCTCATCAGCTGTTTTGGGAGATCTGTGGTAGGGTTTTTGATATACAGAAGGTACCGCACGAGCATTTGCATCCAGATTATGCATACGAGGAGACTGATGTGTATATATTGCGAAAGAAGGTTGTAGAACATAATCAATTGATGGATCCAGTTGATACTCTTGAGTGA

Network for GWHGAAZE002138

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10294.10	Methyltransf_16	16	187	5.00E-27
PF08263.13	LRRNT_2	28	71	9.50E-07
PF07714.18	PK_Tyr_Ser-Thr	326	573	3.90E-29

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-Xa

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.584
	SRR3591706	second leaf	15.545
	SRR3591707	mature leaf	11.989
	SRR3591708	Shoot apex	24.364
	SRR3591709	Stem	16.477
	SRR3591710	White floral bud	25.310
	SRR3591711	White flower	23.225
	SRR3591712	Green floral bud	29.292
	SRR3591713	Yellow flower	22.477
SRP173429	SRR8316895	Juvenile bud stage	12.111
	SRR8316896	Juvenile bud stage	15.703
	SRR8316897	Juvenile bud stage	6.499
	SRR8316894	Third green stage	6.746
	SRR8316900	Third green stage	19.689
	SRR8316901	Third green stage	19.912
	SRR8316898	Complete white stage	8.739
	SRR8316899	Complete white stage	26.983
	SRR8316903	Complete white stage	12.206
	SRR8316902	Silver flowering stage	10.046
	SRR8316904	Silver flowering stage	12.929
	SRR8316905	Silver flowering stage	6.452
	SRR8316906	Gold flowering stage	19.102
	SRR8316907	Gold flowering stage	23.319
	SRR8316908	Gold flowering stage	24.077
SRP132670	SRR6706286	Control	24.131
	SRR6706287	Light intensity 50%	24.927
	SRR6706288	Light intensity 20%	24.971
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.145
	CNS0095593	Slightly white alabastrum(diploid) 2	11.648
	CNS0095594	Slightly white alabastrum(diploid) 3	11.440
	CNS0095595	Whole white alabastrum(diploid) 2	12.078
	CNS0095596	Whole white alabastrum(diploid) 3	13.929
	CNS0095597	Whole white alabastrum(diploid) 4	9.483
	CNS0095598	Silvery flower (diploied) 1	17.219
	CNS0095599	Silvery flower (diploied) 2	6.949
	CNS0095600	Silvery flower (diploied) 3	18.294
	CNS0095601	Golden flower (diploid) 1	8.711
	CNS0095602	Golden flower (diploid) 2	15.346
	CNS0095603	Golden flower (diploid) 3	14.419
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.458
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.209
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.672
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.621
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.652
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.359
	CNS0095610	Silvery flower (tetraploid) 1	13.768
	CNS0095611	Silvery flower (tetraploid) 2	16.080
	CNS0095612	Silvery flower (tetraploid) 3	17.720
	CNS0095613	Golden flower (tetraploid) 1	9.433
	CNS0095614	Golden flower (tetraploid) 2	13.450
	CNS0095615	Golden flower (tetraploid) 3	19.118
CRA001975	CRR073297	Stem 1	18.835
	CRR073298	Stem 2	16.521
	CRR073299	Stem 3	19.089
	CRR073300	Leaf 1	16.962
	CRR073301	Leaf 2	17.964
	CRR073302	Leaf 3	18.861
	CRR073303	Juvenile bud 1	14.177
	CRR073304	Juvenile bud 2	14.232
	CRR073305	Juvenile bud 3	18.726
	CRR073306	Third green 1	11.203
	CRR073307	Third green 2	9.890
	CRR073308	Third green 3	8.603
	CRR073309	Second white 1	11.433
	CRR073310	Second white 2	12.411
	CRR073311	Second white 3	8.193
	CRR073312	Silver flowering 1	5.313
	CRR073313	Silver flowering 2	8.496
	CRR073314	Silver flowering 3	9.564
	CRR073315	Gold flowering 1	8.891
	CRR073316	Gold flowering 2	13.676
	CRR073317	Gold flowering 3	11.559
	CRR073318	Tawny withering 1	18.489
	CRR073319	Tawny withering 2	17.838
	CRR073320	Tawny withering 3	14.774