Gene detail

Detail information of GWHGAAZE002089

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009354283.1	4.65744E-48	PREDICTED: E3 ubiquitin-protein ligase ATL41-like [Pyrus x bretschneideri]
Swissprot	tr\|Q9SLC4\|ATL40_ARATH	1E-32	RING-H2 finger protein ATL40
trEMBL	tr\|M5WKL9\|M5WKL9_PRUPE	1E-44	Uncharacterized protein {ECO:0000313\|EMBL:EMJ13811.1}
TAIR10	AT2G42350.1	5E-28	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	69070441	69070986	+
GWHAAZE00000001	mRNA	69070441	69070986	+
GWHAAZE00000001	exon	69070441	69070986	+
GWHAAZE00000001	CDS	69070441	69070986	+

Transcript Sequence
>GWHTAAZE002093 GATCCTTCACATATACGGAAGGTGTGTCCTCCGCCGCCAAGCCCGCCGCCGTGCCGCCCTCCGGCAGCTTGGTCTCCTCCCCACCCCCACTCCCGACTCCGATATCCACCCGAAAACACACCCAAACCCGGCCTTGACCCATCAATCATCCAATCACTACCAATATTCACTTTCACAAAACTCGCTGGCACCACCGCTGGAGACAAGGCAGCACATCAGGAATGCACAGTTTGCCTTAGCATGCTAGAAGAGGGAGAAATGATTAAGCTCTTACCAAACTGCAAGCACGATTTTCATTCGGAGTGCATCGATAAGTGGCTAGGCTCACACTCGACATGCCCAATTTGTCGGGCTGATGCTGAGCCAAGACTCGTGCTTGAGCCGGAGGCTGTAACTCAGCCAACAGCTCCACCTCTTGAAGGGACATCGGCTAAGGTCAGTAGTGGGTCCGAGTCAAGGTTGACTTCATTTCGAAGGATGCTGAGTAGGGACCAATCATTGAGGCAAATTCAAGAAGATGGTTTACTAGATATTGAGAGACAGTAA

Network for GWHGAAZE002089

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	74	117	2.00E-13
PF00459.26	Inositol_P	95	352	1.90E-65

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
K01092	E3.1.3.25, IMPA, suhB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Inositol phosphate metabolism	map00562
		Streptomycin biosynthesis	map00521
		Phosphatidylinositol signaling system	map04070

Gene Ontology

GO term	Ontology	Name
GO:0046854	biological_process	phosphatidylinositol phosphorylation
GO:0046855	biological_process	inositol phosphate dephosphorylation
GO:0008934	molecular_function	inositol monophosphate 1-phosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.538
	SRR3591706	second leaf	0.911
	SRR3591707	mature leaf	3.068
	SRR3591708	Shoot apex	1.447
	SRR3591709	Stem	5.427
	SRR3591710	White floral bud	1.264
	SRR3591711	White flower	3.604
	SRR3591712	Green floral bud	0.698
	SRR3591713	Yellow flower	4.999
SRP173429	SRR8316895	Juvenile bud stage	1.686
	SRR8316896	Juvenile bud stage	2.560
	SRR8316897	Juvenile bud stage	0.517
	SRR8316894	Third green stage	0.457
	SRR8316900	Third green stage	0.340
	SRR8316901	Third green stage	0.644
	SRR8316898	Complete white stage	0.733
	SRR8316899	Complete white stage	2.752
	SRR8316903	Complete white stage	1.822
	SRR8316902	Silver flowering stage	1.161
	SRR8316904	Silver flowering stage	1.028
	SRR8316905	Silver flowering stage	0.841
	SRR8316906	Gold flowering stage	4.103
	SRR8316907	Gold flowering stage	4.874
	SRR8316908	Gold flowering stage	4.002
SRP132670	SRR6706286	Control	4.222
	SRR6706287	Light intensity 50%	2.851
	SRR6706288	Light intensity 20%	0.987
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.644
	CNS0095593	Slightly white alabastrum(diploid) 2	0.925
	CNS0095594	Slightly white alabastrum(diploid) 3	2.577
	CNS0095595	Whole white alabastrum(diploid) 2	0.399
	CNS0095596	Whole white alabastrum(diploid) 3	0.100
	CNS0095597	Whole white alabastrum(diploid) 4	0.923
	CNS0095598	Silvery flower (diploied) 1	3.806
	CNS0095599	Silvery flower (diploied) 2	4.445
	CNS0095600	Silvery flower (diploied) 3	1.517
	CNS0095601	Golden flower (diploid) 1	6.394
	CNS0095602	Golden flower (diploid) 2	6.824
	CNS0095603	Golden flower (diploid) 3	5.373
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.307
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.412
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.209
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.580
	CNS0095611	Silvery flower (tetraploid) 2	0.199
	CNS0095612	Silvery flower (tetraploid) 3	0.201
	CNS0095613	Golden flower (tetraploid) 1	0.186
	CNS0095614	Golden flower (tetraploid) 2	0.776
	CNS0095615	Golden flower (tetraploid) 3	0.410
CRA001975	CRR073297	Stem 1	3.676
	CRR073298	Stem 2	1.230
	CRR073299	Stem 3	2.667
	CRR073300	Leaf 1	0.720
	CRR073301	Leaf 2	1.058
	CRR073302	Leaf 3	0.751
	CRR073303	Juvenile bud 1	0.283
	CRR073304	Juvenile bud 2	0.038
	CRR073305	Juvenile bud 3	0.490
	CRR073306	Third green 1	0.362
	CRR073307	Third green 2	0.346
	CRR073308	Third green 3	0.353
	CRR073309	Second white 1	0.919
	CRR073310	Second white 2	0.756
	CRR073311	Second white 3	0.184
	CRR073312	Silver flowering 1	2.900
	CRR073313	Silver flowering 2	2.067
	CRR073314	Silver flowering 3	0.923
	CRR073315	Gold flowering 1	5.878
	CRR073316	Gold flowering 2	6.275
	CRR073317	Gold flowering 3	15.523
	CRR073318	Tawny withering 1	21.051
	CRR073319	Tawny withering 2	22.852
	CRR073320	Tawny withering 3	3.731