Gene detail

Detail information of GWHGAAZE002062

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010313869.1	6.53392E-32	PREDICTED: uncharacterized protein LOC101257540 isoform X2 [Solanum lycopersicum]
trEMBL	tr\|K4DCH2\|K4DCH2_SOLLC	3E-32	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc12g010850.1.1}
TAIR10	AT1G06320.1	2E-18	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	68509311	68510403	-
GWHAAZE00000001	mRNA	68509311	68510403	-
GWHAAZE00000001	exon	68510266	68510403	-
GWHAAZE00000001	exon	68509888	68509929	-
GWHAAZE00000001	exon	68509311	68509789	-
GWHAAZE00000001	CDS	68510266	68510403	-
GWHAAZE00000001	CDS	68509888	68509929	-
GWHAAZE00000001	CDS	68509367	68509789	-
GWHAAZE00000001	three_prime_UTR	68509311	68509366	-

Transcript Sequence
>GWHTAAZE002066 ATGGAAATTGTGCAATGTGGACAATTCAATCCAATAATGAGAGGCGAGAAGAAGAGAAGTAAGATATCTCTCGAAGAATACCTAGATTTCGTTGATTCGCGCAACCAATTGCATCTCACCGTCAATCATCTCCATCAGATCATGAGTATCCACGGATTCAGAAAAGCACAGGCTCAAAAGAAGGTTCTGATCGAAGCAGTGAACTCAATAGAACTAATTCACCCCTCTCGCTCCACAATCCAAAACGACAACGTCTCTTCCTGCGCTTTTATTCCCATGGAGGTGGTAATCAAGGACTTGGTTGACCTCAACTGGCAAGAATGCACTGTCACTTCACTCCAAACCCTAAATTTCATGAATTACAATTTTAGCCTCCAAAATTCCATTGCTTCAACATCCAAACGGAAGCCTAAGAGATCGAGGAAGGATTTGCCGCGATTGGAAGGTGTTGTTGACGCCGACACGGCCATCGTTGCCCTCGCCGCCGCTAAACCTTCCGGCGAGATCGGAGGAACACGCTCGGATTGTTCTGTAGCGGTTGATTATCAGTGCGATGATAGGAAGAGGAAAATGAAGAGTACTGATGCCTCGATGATGGATTAAGTATTCTACGGGTGAGTTTCCGATGTCAAAATTCTGTTTATTTTCATTCATCTGTT

Network for GWHGAAZE002062

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00547.19	Urease_gamma	1	100	1.10E-40
PF00699.21	Urease_beta	133	229	1.40E-41
PF18473.2	Urease_linker	231	261	4.60E-07
PF00449.21	Urease_alpha	270	389	4.60E-55
PF01979.21	Amidohydro_1	395	739	4.30E-73

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01427	URE	Metabolic pathways	map01100
		Microbial metabolism in diverse environments	map01120
		Purine metabolism	map00230
		Arginine biosynthesis	map00220
		Atrazine degradation	map00791

Gene Ontology

GO term	Ontology	Name
GO:0043419	biological_process	urea catabolic process
GO:0006807	biological_process	nitrogen compound metabolic process
GO:0016151	molecular_function	nickel cation binding
GO:0009039	molecular_function	urease activity
GO:0016810	molecular_function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.710
	SRR3591706	second leaf	0.932
	SRR3591707	mature leaf	0.814
	SRR3591708	Shoot apex	5.076
	SRR3591709	Stem	1.755
	SRR3591710	White floral bud	0.950
	SRR3591711	White flower	0.214
	SRR3591712	Green floral bud	1.208
	SRR3591713	Yellow flower	0.712
SRP173429	SRR8316895	Juvenile bud stage	0.788
	SRR8316896	Juvenile bud stage	1.383
	SRR8316897	Juvenile bud stage	0.760
	SRR8316894	Third green stage	0.622
	SRR8316900	Third green stage	1.030
	SRR8316901	Third green stage	0.696
	SRR8316898	Complete white stage	0.150
	SRR8316899	Complete white stage	1.604
	SRR8316903	Complete white stage	0.319
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.080
	SRR8316905	Silver flowering stage	0.156
	SRR8316906	Gold flowering stage	0.415
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.369
SRP132670	SRR6706286	Control	0.514
	SRR6706287	Light intensity 50%	0.625
	SRR6706288	Light intensity 20%	1.137
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.095
	CNS0095593	Slightly white alabastrum(diploid) 2	2.170
	CNS0095594	Slightly white alabastrum(diploid) 3	0.924
	CNS0095595	Whole white alabastrum(diploid) 2	1.817
	CNS0095596	Whole white alabastrum(diploid) 3	0.440
	CNS0095597	Whole white alabastrum(diploid) 4	0.344
	CNS0095598	Silvery flower (diploied) 1	0.242
	CNS0095599	Silvery flower (diploied) 2	0.583
	CNS0095600	Silvery flower (diploied) 3	0.176
	CNS0095601	Golden flower (diploid) 1	0.030
	CNS0095602	Golden flower (diploid) 2	0.666
	CNS0095603	Golden flower (diploid) 3	0.337
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.525
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.558
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.702
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.956
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.862
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.717
	CNS0095610	Silvery flower (tetraploid) 1	0.912
	CNS0095611	Silvery flower (tetraploid) 2	0.724
	CNS0095612	Silvery flower (tetraploid) 3	1.182
	CNS0095613	Golden flower (tetraploid) 1	1.114
	CNS0095614	Golden flower (tetraploid) 2	0.727
	CNS0095615	Golden flower (tetraploid) 3	0.800
CRA001975	CRR073297	Stem 1	1.324
	CRR073298	Stem 2	1.263
	CRR073299	Stem 3	3.008
	CRR073300	Leaf 1	0.616
	CRR073301	Leaf 2	1.329
	CRR073302	Leaf 3	0.410
	CRR073303	Juvenile bud 1	0.614
	CRR073304	Juvenile bud 2	0.505
	CRR073305	Juvenile bud 3	0.211
	CRR073306	Third green 1	0.330
	CRR073307	Third green 2	0.107
	CRR073308	Third green 3	0.531
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.385
	CRR073311	Second white 3	0.186
	CRR073312	Silver flowering 1	0.119
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.994
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	3.532
	CRR073319	Tawny withering 2	2.656
	CRR073320	Tawny withering 3	2.913