Gene detail

Detail information of GWHGAAZE002061

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDX79272.1	1.75782E-91	BnaC06g20310D [Brassica napus]
COG	YP_008797956.1	6E-14	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|Q9FZ48\|UBC36_ARATH	3E-93	Ubiquitin-conjugating enzyme E2 36
trEMBL	tr\|A0A078CRB0\|A0A078CRB0_BRANA	7E-92	BnaC06g20310D protein {ECO:0000313\|EMBL:CDX79272.1}
TAIR10	AT1G16890.2	6E-73	ubiquitin-conjugating enzyme 36

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	68497006	68507561	+
GWHAAZE00000001	mRNA	68497006	68507561	+
GWHAAZE00000001	exon	68497006	68497041	+
GWHAAZE00000001	exon	68497260	68497287	+
GWHAAZE00000001	exon	68497500	68497586	+
GWHAAZE00000001	exon	68500851	68500909	+
GWHAAZE00000001	exon	68502940	68503002	+
GWHAAZE00000001	exon	68505785	68505858	+
GWHAAZE00000001	exon	68506495	68506592	+
GWHAAZE00000001	exon	68507524	68507561	+
GWHAAZE00000001	CDS	68497006	68497041	+
GWHAAZE00000001	CDS	68497260	68497287	+
GWHAAZE00000001	CDS	68497500	68497586	+
GWHAAZE00000001	CDS	68500851	68500909	+
GWHAAZE00000001	CDS	68502940	68503002	+
GWHAAZE00000001	CDS	68505785	68505858	+
GWHAAZE00000001	CDS	68506495	68506592	+
GWHAAZE00000001	CDS	68507524	68507561	+

Transcript Sequence
>GWHTAAZE002065 ATGGCGAATAGCAATTTACCTCGAAGGATTATCAAGGAAACACAGCGACTTCTCAGTGAACCAGCTCCAGGAATTAGTGCTTCTCCATCTGAAGAGAATATGCGATATTTTAATGTGATGATACTTGGTCCAAGCCAATCTCCTTATGAAGGAGGGGTATTCAAGTTGGAATTGTTTTTGCCTGAAGAGTATCCAATGGCAGCTCCCAAGTTTGGTGTGATAATCGGCGGTGAAGGTGGAGTCTTCGACGGTGAGGGTGTGAGAATCGCGCTGCTTGGGAGAATATGCCTCGATATTCTCAAAGACAAATGGAGTCCAGCCCTCCAGATCCGTACAGTATTGCTGAGCATCCAAGCTCTTCTTAGCGCTCCAAACCCTGATGATCCACTTTCCGAGAACGTTGCGAAGCATTGGAAGAGTAATGAAGCTGATGCCGTTGAAACCGCGAAAGAATGGACCCGTTTGTATGCAACTGGTGCTTGA

Network for GWHGAAZE002061

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	9	151	2.40E-35
PF13837.7	Myb_DNA-bind_4	218	309	2.50E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Trihelix
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10580	UBE2N, BLU, UBC13	Ubiquitin mediated proteolysis	map04120
K10580	UBE2N, BLU, UBC13	Toll and Imd signaling pathway	map04624

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	155.856
	SRR3591706	second leaf	58.479
	SRR3591707	mature leaf	62.139
	SRR3591708	Shoot apex	101.258
	SRR3591709	Stem	155.499
	SRR3591710	White floral bud	96.746
	SRR3591711	White flower	120.699
	SRR3591712	Green floral bud	113.606
	SRR3591713	Yellow flower	160.206
SRP173429	SRR8316895	Juvenile bud stage	53.591
	SRR8316896	Juvenile bud stage	74.384
	SRR8316897	Juvenile bud stage	45.993
	SRR8316894	Third green stage	37.499
	SRR8316900	Third green stage	117.208
	SRR8316901	Third green stage	116.791
	SRR8316898	Complete white stage	66.255
	SRR8316899	Complete white stage	178.194
	SRR8316903	Complete white stage	95.613
	SRR8316902	Silver flowering stage	62.063
	SRR8316904	Silver flowering stage	84.830
	SRR8316905	Silver flowering stage	41.870
	SRR8316906	Gold flowering stage	143.601
	SRR8316907	Gold flowering stage	139.651
	SRR8316908	Gold flowering stage	138.163
SRP132670	SRR6706286	Control	66.121
	SRR6706287	Light intensity 50%	67.913
	SRR6706288	Light intensity 20%	72.674
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	77.360
	CNS0095593	Slightly white alabastrum(diploid) 2	93.490
	CNS0095594	Slightly white alabastrum(diploid) 3	71.867
	CNS0095595	Whole white alabastrum(diploid) 2	76.978
	CNS0095596	Whole white alabastrum(diploid) 3	80.447
	CNS0095597	Whole white alabastrum(diploid) 4	78.317
	CNS0095598	Silvery flower (diploied) 1	67.291
	CNS0095599	Silvery flower (diploied) 2	79.381
	CNS0095600	Silvery flower (diploied) 3	107.447
	CNS0095601	Golden flower (diploid) 1	67.582
	CNS0095602	Golden flower (diploid) 2	95.252
	CNS0095603	Golden flower (diploid) 3	96.106
	CNS0095604	Slightly white alabastrum(tetraploid) 1	68.764
	CNS0095605	Slightly white alabastrum(tetraploid) 2	61.923
	CNS0095606	Slightly white alabastrum(tetraploid) 3	72.804
	CNS0095607	Whole white alabastrum(tetraploid) 1	49.586
	CNS0095608	Whole white alabastrum(tetraploid) 2	46.478
	CNS0095609	Whole white alabastrum(tetraploid) 3	61.865
	CNS0095610	Silvery flower (tetraploid) 1	81.729
	CNS0095611	Silvery flower (tetraploid) 2	106.640
	CNS0095612	Silvery flower (tetraploid) 3	90.257
	CNS0095613	Golden flower (tetraploid) 1	77.690
	CNS0095614	Golden flower (tetraploid) 2	73.985
	CNS0095615	Golden flower (tetraploid) 3	110.838
CRA001975	CRR073297	Stem 1	61.287
	CRR073298	Stem 2	59.399
	CRR073299	Stem 3	58.566
	CRR073300	Leaf 1	75.042
	CRR073301	Leaf 2	79.441
	CRR073302	Leaf 3	78.192
	CRR073303	Juvenile bud 1	92.279
	CRR073304	Juvenile bud 2	77.824
	CRR073305	Juvenile bud 3	96.083
	CRR073306	Third green 1	58.692
	CRR073307	Third green 2	72.939
	CRR073308	Third green 3	59.359
	CRR073309	Second white 1	119.891
	CRR073310	Second white 2	72.135
	CRR073311	Second white 3	66.065
	CRR073312	Silver flowering 1	73.185
	CRR073313	Silver flowering 2	87.652
	CRR073314	Silver flowering 3	62.021
	CRR073315	Gold flowering 1	49.831
	CRR073316	Gold flowering 2	39.478
	CRR073317	Gold flowering 3	41.505
	CRR073318	Tawny withering 1	87.539
	CRR073319	Tawny withering 2	91.867
	CRR073320	Tawny withering 3	107.857