Gene detail

Detail information of GWHGAAZE002042

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP15958.1	3.923E-125	unnamed protein product [Coffea canephora]
COG	YP_008431664.1	7E-20	hypothetical protein N186_01315
Swissprot	tr\|Q01111\|YPT3_NICPL	2E-121	Ras-related protein YPT3
trEMBL	tr\|A0A068V7R7\|A0A068V7R7_COFCA	1E-125	Coffea canephora DH200=94 genomic scaffold, scaffold_112 {ECO:0000313\|EMBL:CDP15958.1}
TAIR10	AT1G16920.1	2E-91	RAB GTPase homolog A1B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	67741427	67746118	-
GWHAAZE00000001	mRNA	67741427	67746118	-
GWHAAZE00000001	exon	67745898	67746118	-
GWHAAZE00000001	exon	67741427	67741832	-
GWHAAZE00000001	CDS	67745898	67746118	-
GWHAAZE00000001	CDS	67741427	67741832	-

Transcript Sequence
>GWHTAAZE002046 ATGAGTGGGTATAGAGCTGAAGATGAATACGATTACTTGTTCAAATTGGTACTAATCGGTGATTCGGGTGTCGGAAAATCCAATCTCCTCTCCAGGTTTACTAGGAACGAGTTCAATCTAGAGTCCAAATCCACAATTGGAGTTGAATTTGCCACTCGGAGTCTCACCGTCGATGGTAAAGTTATCAAAGCTCAGATTTGGGACACTGCTGGTCAAGAAAGGAGCTGTCGGGCGCTACTCGTATACGACGTCACACGCCACATCACCTTTGAGAATGTTGAGAGGTGGTTGAAGGAGTTAAGGGGGCACACTGATCCCAATGCGGTGGTAATGCTCATCGGCAACAAGTCCGATCTCCGGCACCTCGTGGCGGTTCCGACTGAGGACGGTAAATCTTTCGCGGAGAAAGAATCCCTCTATTTTATGGAGACCTCGGCCCTCGAAGCTACGAATGTCGAAAATGCATTCGCCGAGGTTCTTACTCAGATATACCGCGTTGTGAGCAAGAAGGCGGTTGAGGCCAGTGATGAAGGTGCTGCTACTTCTTCCGTTTCATTAAAAGGAGAAACAATTGATGTTAAAGATGACGGTTCTGGTTTTAAGAGATTCGGGTGCTGCTCGAGCTAG

Network for GWHGAAZE002042

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	15	164	4.20E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07904	RAB11A	Endocytosis	map04144
		Pancreatic secretion	map04972
		Vasopressin-regulated water reabsorption	map04962
		Endocrine and other factor-regulated calcium reabsorption	map04961

Gene Ontology

GO term	Ontology	Name
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	26.877
	SRR3591706	second leaf	23.899
	SRR3591707	mature leaf	27.609
	SRR3591708	Shoot apex	18.115
	SRR3591709	Stem	45.000
	SRR3591710	White floral bud	68.252
	SRR3591711	White flower	100.751
	SRR3591712	Green floral bud	43.582
	SRR3591713	Yellow flower	95.354
SRP173429	SRR8316895	Juvenile bud stage	25.345
	SRR8316896	Juvenile bud stage	34.363
	SRR8316897	Juvenile bud stage	14.806
	SRR8316894	Third green stage	15.116
	SRR8316900	Third green stage	56.471
	SRR8316901	Third green stage	49.920
	SRR8316898	Complete white stage	65.133
	SRR8316899	Complete white stage	94.663
	SRR8316903	Complete white stage	99.539
	SRR8316902	Silver flowering stage	85.323
	SRR8316904	Silver flowering stage	102.052
	SRR8316905	Silver flowering stage	62.342
	SRR8316906	Gold flowering stage	203.409
	SRR8316907	Gold flowering stage	210.754
	SRR8316908	Gold flowering stage	201.432
SRP132670	SRR6706286	Control	76.937
	SRR6706287	Light intensity 50%	74.761
	SRR6706288	Light intensity 20%	73.068
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	46.018
	CNS0095593	Slightly white alabastrum(diploid) 2	45.471
	CNS0095594	Slightly white alabastrum(diploid) 3	28.518
	CNS0095595	Whole white alabastrum(diploid) 2	38.600
	CNS0095596	Whole white alabastrum(diploid) 3	37.468
	CNS0095597	Whole white alabastrum(diploid) 4	38.427
	CNS0095598	Silvery flower (diploied) 1	77.729
	CNS0095599	Silvery flower (diploied) 2	72.882
	CNS0095600	Silvery flower (diploied) 3	138.169
	CNS0095601	Golden flower (diploid) 1	85.455
	CNS0095602	Golden flower (diploid) 2	117.174
	CNS0095603	Golden flower (diploid) 3	105.007
	CNS0095604	Slightly white alabastrum(tetraploid) 1	52.852
	CNS0095605	Slightly white alabastrum(tetraploid) 2	47.386
	CNS0095606	Slightly white alabastrum(tetraploid) 3	89.076
	CNS0095607	Whole white alabastrum(tetraploid) 1	37.587
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.629
	CNS0095609	Whole white alabastrum(tetraploid) 3	60.178
	CNS0095610	Silvery flower (tetraploid) 1	181.676
	CNS0095611	Silvery flower (tetraploid) 2	160.924
	CNS0095612	Silvery flower (tetraploid) 3	165.031
	CNS0095613	Golden flower (tetraploid) 1	181.338
	CNS0095614	Golden flower (tetraploid) 2	183.442
	CNS0095615	Golden flower (tetraploid) 3	238.308
CRA001975	CRR073297	Stem 1	43.793
	CRR073298	Stem 2	42.482
	CRR073299	Stem 3	44.439
	CRR073300	Leaf 1	47.799
	CRR073301	Leaf 2	49.972
	CRR073302	Leaf 3	44.548
	CRR073303	Juvenile bud 1	55.088
	CRR073304	Juvenile bud 2	71.635
	CRR073305	Juvenile bud 3	47.151
	CRR073306	Third green 1	74.002
	CRR073307	Third green 2	66.616
	CRR073308	Third green 3	69.413
	CRR073309	Second white 1	92.405
	CRR073310	Second white 2	95.926
	CRR073311	Second white 3	71.874
	CRR073312	Silver flowering 1	60.225
	CRR073313	Silver flowering 2	58.990
	CRR073314	Silver flowering 3	57.218
	CRR073315	Gold flowering 1	15.690
	CRR073316	Gold flowering 2	15.805
	CRR073317	Gold flowering 3	16.675
	CRR073318	Tawny withering 1	30.689
	CRR073319	Tawny withering 2	24.615
	CRR073320	Tawny withering 3	34.142