Gene detail

Detail information of GWHGAAZE002038

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082978.1	1.7993E-145	PREDICTED: probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7 [Sesamum indicum]
COG	YP_004625437.1	9E-35	alpha,alpha-trehalose-phosphate synthase
Swissprot	tr\|Q9LMI0\|TPS7_ARATH	1E-133	Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7
trEMBL	tr\|A0A059DGX1\|A0A059DGX1_EUCGR	2E-144	Uncharacterized protein {ECO:0000313\|EMBL:KCW89661.1}
TAIR10	AT1G06410.1	3E-112	trehalose-phosphatase/synthase 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	67609195	67610508	-
GWHAAZE00000001	mRNA	67609195	67610508	-
GWHAAZE00000001	exon	67610318	67610508	-
GWHAAZE00000001	exon	67609195	67610001	-
GWHAAZE00000001	five_prime_UTR	67610318	67610508	-
GWHAAZE00000001	five_prime_UTR	67609939	67610001	-
GWHAAZE00000001	CDS	67609195	67609938	-

Transcript Sequence
>GWHTAAZE002042 GCAAAGAGATCACTATATATTATTATATTTGTATATTCATACCTGTACAAAGAACGAACCCTAAATATTATTTATTATTTTTTGGTTTGGTTTGGTTGTATCGAACAATATTCAAACCCTAGAATTCTTCTCCAATTTGGACCTTTGAAGAAGATCGAGCTGTCAATTTCTTTGATCATTCAATCACACAGATAATTTGAAATTAGCTATTTGAAACACAAGAGAATTGTGGTTTTTGAGAGATTCCTGTGAAAATGTTGTCCAGATCTTATACCAATCTTTTAGATTTAGCATCTGGGAATTTTCCAGTAATGGGTAGGGAGAGAGAGCGGAAGCGAATGCCCAGAGTAATGACAGTACCAGGGAGTATTGCTGAGCTTGATGATGATCAAGCTCATAGTGTTTCATCAGATAACCCTTCTTCACTTGCTACTGATAGAATGATTATTGTGGCAAATCAATTACCCCTAAAAGCTAAGCGAAGGCCAGATAATAAAGGATGGAGCTTCAGTTGGGATGAGGACTCGTTGCTTTTGCGACTTAAGGATGGTTTTCCTGATGACATGGAAGTGCAATACATTGGATCGTTGAGTGTCGATGTTGATCCAATTGAACAGGAGGATGTTGCCCAACTCCTCTTGGAGAAATTTAGATGCGTTCCTACTTTTTTGCCACCTAATCTTCTGCAAAAATTTTATGATGGATTCTGCAAGAAGCAATTATGGCCTCTTTTTCACTACATGTTGCCGTATTCGGCTGATCAAGGAGGACGGTTTGATCGTTCTGCGTGGGAATCATATGTCTCTGCAAATAAGTTGTTTTCTCAAAAGGTGATTGAGGTGCTAAATCCCGAAGATGATTTTGTTTGGATTCATGATTATCATTTGATGGTATTGCCGACGTTCTTGAGGAGGCGTTTCAACCGTTTGAGAATGGGTTTTTTCCTTCACAGTCCATTTCCTTCGTCCGAGATTTACAGGACACTTCCTGTTAGAGAG

Network for GWHGAAZE002038

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00982.22	Glyco_transf_20	62	248	1.50E-62
PF03083.17	MtN3_slv	14	82	1.60E-12
PF03083.17	MtN3_slv	119	201	1.70E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16055	TPS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0005992	biological_process	trehalose biosynthetic process
GO:0016021	cellular_component	integral component of membrane
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.770
	SRR3591706	second leaf	12.535
	SRR3591707	mature leaf	11.357
	SRR3591708	Shoot apex	16.796
	SRR3591709	Stem	18.230
	SRR3591710	White floral bud	35.890
	SRR3591711	White flower	31.829
	SRR3591712	Green floral bud	21.869
	SRR3591713	Yellow flower	29.723
SRP173429	SRR8316895	Juvenile bud stage	10.354
	SRR8316896	Juvenile bud stage	13.295
	SRR8316897	Juvenile bud stage	8.040
	SRR8316894	Third green stage	5.789
	SRR8316900	Third green stage	14.224
	SRR8316901	Third green stage	14.614
	SRR8316898	Complete white stage	12.352
	SRR8316899	Complete white stage	23.538
	SRR8316903	Complete white stage	23.842
	SRR8316902	Silver flowering stage	12.140
	SRR8316904	Silver flowering stage	25.506
	SRR8316905	Silver flowering stage	10.315
	SRR8316906	Gold flowering stage	31.211
	SRR8316907	Gold flowering stage	26.291
	SRR8316908	Gold flowering stage	27.856
SRP132670	SRR6706286	Control	8.522
	SRR6706287	Light intensity 50%	10.306
	SRR6706288	Light intensity 20%	11.170
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.824
	CNS0095593	Slightly white alabastrum(diploid) 2	3.153
	CNS0095594	Slightly white alabastrum(diploid) 3	5.177
	CNS0095595	Whole white alabastrum(diploid) 2	3.926
	CNS0095596	Whole white alabastrum(diploid) 3	3.877
	CNS0095597	Whole white alabastrum(diploid) 4	6.207
	CNS0095598	Silvery flower (diploied) 1	16.330
	CNS0095599	Silvery flower (diploied) 2	12.287
	CNS0095600	Silvery flower (diploied) 3	36.458
	CNS0095601	Golden flower (diploid) 1	9.174
	CNS0095602	Golden flower (diploid) 2	37.791
	CNS0095603	Golden flower (diploid) 3	38.504
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.058
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.668
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.501
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.718
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.941
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.326
	CNS0095610	Silvery flower (tetraploid) 1	34.086
	CNS0095611	Silvery flower (tetraploid) 2	42.263
	CNS0095612	Silvery flower (tetraploid) 3	32.982
	CNS0095613	Golden flower (tetraploid) 1	13.497
	CNS0095614	Golden flower (tetraploid) 2	26.279
	CNS0095615	Golden flower (tetraploid) 3	55.147
CRA001975	CRR073297	Stem 1	10.448
	CRR073298	Stem 2	11.278
	CRR073299	Stem 3	8.109
	CRR073300	Leaf 1	9.897
	CRR073301	Leaf 2	5.650
	CRR073302	Leaf 3	7.223
	CRR073303	Juvenile bud 1	5.630
	CRR073304	Juvenile bud 2	11.158
	CRR073305	Juvenile bud 3	11.994
	CRR073306	Third green 1	9.009
	CRR073307	Third green 2	6.926
	CRR073308	Third green 3	9.538
	CRR073309	Second white 1	9.389
	CRR073310	Second white 2	9.158
	CRR073311	Second white 3	11.204
	CRR073312	Silver flowering 1	9.386
	CRR073313	Silver flowering 2	8.934
	CRR073314	Silver flowering 3	5.751
	CRR073315	Gold flowering 1	5.676
	CRR073316	Gold flowering 2	10.536
	CRR073317	Gold flowering 3	10.272
	CRR073318	Tawny withering 1	5.433
	CRR073319	Tawny withering 2	5.237
	CRR073320	Tawny withering 3	4.377