Gene detail

Detail information of GWHGAAZE001979

Functional Annotation

Database	Orthologs	E value	Annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	66305612	66306363	-
GWHAAZE00000001	mRNA	66305612	66306363	-
GWHAAZE00000001	exon	66305612	66305644	-
GWHAAZE00000001	exon	66306292	66306363	-
GWHAAZE00000001	CDS	66306292	66306363	-
GWHAAZE00000001	CDS	66305612	66305644	-

Transcript Sequence
>GWHTAAZE001983 ATGGCCACTCATGGGTCAAATGCCAATATAATGTTAGTTACTGCTCATCTTGCCAAATCAAGAAATTGCAAGGTTCAAGGTCAGAATTCTTGCAGACAATCTTGA

Network for GWHGAAZE001979

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	40	317	1.90E-46

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIIa-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005524	molecular_function	ATP binding
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.937
	SRR3591711	White flower	3.761
	SRR3591712	Green floral bud	0.399
	SRR3591713	Yellow flower	1.196
SRP173429	SRR8316895	Juvenile bud stage	1.246
	SRR8316896	Juvenile bud stage	1.374
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.217
	SRR8316900	Third green stage	1.662
	SRR8316901	Third green stage	0.397
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	5.783
	SRR8316903	Complete white stage	0.574
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.118
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.173
SRP132670	SRR6706286	Control	0.036
	SRR6706287	Light intensity 50%	0.235
	SRR6706288	Light intensity 20%	0.464
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.685
	CNS0095593	Slightly white alabastrum(diploid) 2	2.430
	CNS0095594	Slightly white alabastrum(diploid) 3	3.583
	CNS0095595	Whole white alabastrum(diploid) 2	0.882
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	2.104
	CNS0095598	Silvery flower (diploied) 1	0.160
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.704
	CNS0095601	Golden flower (diploid) 1	1.859
	CNS0095602	Golden flower (diploid) 2	0.152
	CNS0095603	Golden flower (diploid) 3	0.351
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.069
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.405
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.070
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.530
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.176
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.257
	CNS0095610	Silvery flower (tetraploid) 1	0.517
	CNS0095611	Silvery flower (tetraploid) 2	13.934
	CNS0095612	Silvery flower (tetraploid) 3	4.101
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	1.620
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.205
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.179
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000