Gene detail

Detail information of GWHGAAZE001906

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU43426.1	2.13524E-60	hypothetical protein MIMGU_mgv1a018638mg, partial [Erythranthe guttata]
COG	YP_007121097.1	0.00000002	cytochrome P450
Swissprot	tr\|H2DH21\|C7A29_PANGI	8E-61	Cytochrome P450 CYP72A219
trEMBL	tr\|A0A022RTW3\|A0A022RTW3_ERYGU	8E-61	Uncharacterized protein {ECO:0000313\|EMBL:EYU43426.1} (Fragment)
TAIR10	AT3G14660.1	2E-44	cytochrome P450, family 72, subfamily A, polypeptide 13

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	64329685	64334208	+
GWHAAZE00000001	mRNA	64329685	64334208	+
GWHAAZE00000001	exon	64329685	64329859	+
GWHAAZE00000001	exon	64333353	64333573	+
GWHAAZE00000001	exon	64334125	64334208	+
GWHAAZE00000001	CDS	64329685	64329859	+
GWHAAZE00000001	CDS	64333353	64333573	+
GWHAAZE00000001	CDS	64334125	64334208	+

Transcript Sequence
>GWHTAAZE001910 ATGGAGGTGCACCTCAGAGCCCAAGGTCTCAATGGAAATCCCTACAGGCTACTGGTTGGAGATGTCAAAGAGATCGCCCTTATGAGAAAAGAAGCAATCGTCGACCCCATAAATTTATCCGACGACGTCGTTCCACGCCTCATCCCCTTTGTCCACAACTCCTTCCAAAAATATGGTAAGAATTTTTTTGTATGGCTTGGACCAAGACCAATGGTGCATATAATGGACCCCGATGTAATAAAAGAGGTGTTGACTAAGATTAATCAGTTTCCAAAACCCAAGACAGGAAACCCATTATCCAGGTTCCTAGTAACTGGACTTATAACCTATGAGGGTGACAAATGGAATAAACACAGAAAAACTATCAACCCTGCTTTCCATCTCGAGAAACTCAAGTGTATGCTTCCGGCCTTTAAGTTGAGTTGTAGTGAGATGATCAAAAAATGGGAGGAAAGAGTACTTGAGAAAGGGTCATCATGA

Network for GWHGAAZE001906

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	51	156	8.10E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12604	CNOT1, NOT1	RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.368
	SRR3591706	second leaf	0.195
	SRR3591707	mature leaf	1.068
	SRR3591708	Shoot apex	0.107
	SRR3591709	Stem	1.284
	SRR3591710	White floral bud	3.986
	SRR3591711	White flower	1.044
	SRR3591712	Green floral bud	1.337
	SRR3591713	Yellow flower	3.137
SRP173429	SRR8316895	Juvenile bud stage	2.738
	SRR8316896	Juvenile bud stage	2.252
	SRR8316897	Juvenile bud stage	1.102
	SRR8316894	Third green stage	1.167
	SRR8316900	Third green stage	1.126
	SRR8316901	Third green stage	1.115
	SRR8316898	Complete white stage	1.309
	SRR8316899	Complete white stage	3.953
	SRR8316903	Complete white stage	3.440
	SRR8316902	Silver flowering stage	1.960
	SRR8316904	Silver flowering stage	3.715
	SRR8316905	Silver flowering stage	0.825
	SRR8316906	Gold flowering stage	1.577
	SRR8316907	Gold flowering stage	2.152
	SRR8316908	Gold flowering stage	1.310
SRP132670	SRR6706286	Control	6.933
	SRR6706287	Light intensity 50%	3.453
	SRR6706288	Light intensity 20%	1.549
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.024
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	1.421
	CNS0095595	Whole white alabastrum(diploid) 2	0.054
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.577
	CNS0095598	Silvery flower (diploied) 1	0.843
	CNS0095599	Silvery flower (diploied) 2	1.331
	CNS0095600	Silvery flower (diploied) 3	6.103
	CNS0095601	Golden flower (diploid) 1	1.006
	CNS0095602	Golden flower (diploid) 2	5.529
	CNS0095603	Golden flower (diploid) 3	6.770
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.523
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.160
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.338
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.073
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.062
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.842
	CNS0095610	Silvery flower (tetraploid) 1	5.080
	CNS0095611	Silvery flower (tetraploid) 2	6.206
	CNS0095612	Silvery flower (tetraploid) 3	3.957
	CNS0095613	Golden flower (tetraploid) 1	4.607
	CNS0095614	Golden flower (tetraploid) 2	2.180
	CNS0095615	Golden flower (tetraploid) 3	13.436
CRA001975	CRR073297	Stem 1	2.825
	CRR073298	Stem 2	4.529
	CRR073299	Stem 3	6.954
	CRR073300	Leaf 1	1.810
	CRR073301	Leaf 2	1.028
	CRR073302	Leaf 3	0.162
	CRR073303	Juvenile bud 1	1.556
	CRR073304	Juvenile bud 2	0.545
	CRR073305	Juvenile bud 3	2.862
	CRR073306	Third green 1	1.042
	CRR073307	Third green 2	2.669
	CRR073308	Third green 3	1.335
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.302
	CRR073311	Second white 3	0.279
	CRR073312	Silver flowering 1	0.245
	CRR073313	Silver flowering 2	0.265
	CRR073314	Silver flowering 3	0.345
	CRR073315	Gold flowering 1	0.964
	CRR073316	Gold flowering 2	4.877
	CRR073317	Gold flowering 3	4.073
	CRR073318	Tawny withering 1	9.988
	CRR073319	Tawny withering 2	12.018
	CRR073320	Tawny withering 3	2.313