Gene detail

Detail information of GWHGAAZE001869

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI39884.3	1.05667E-58	unnamed protein product [Vitis vinifera]
COG	YP_001522424.1	0.0000005	cytochrome P450 family protein
Swissprot	tr\|H2DH21\|C7A29_PANGI	1E-60	Cytochrome P450 CYP72A219
trEMBL	tr\|F6I4Y1\|F6I4Y1_VITVI	8E-59	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB62076.1}
TAIR10	AT3G14690.1	2E-41	cytochrome P450, family 72, subfamily A, polypeptide 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63260203	63263931	-
GWHAAZE00000001	mRNA	63260203	63263931	-
GWHAAZE00000001	exon	63263649	63263931	-
GWHAAZE00000001	exon	63260203	63260474	-
GWHAAZE00000001	CDS	63263649	63263931	-
GWHAAZE00000001	CDS	63260203	63260474	-

Transcript Sequence
>GWHTAAZE001873 ATGGATGCAATAGTAGTACTGTACAACTCAGTTGCAGCTTGCTGTGCTGTAGCAGTTGTACTCTGGGCATGGAGGATGTTTGATTTGGTGTGGGTGAGGCCCATGAAGAGAGATAAGTACCTCCGAAATCAAGGCTTCAAGGGAAGCTCTTACAACCTTCTCTTTGGAGATATCAAAAGGATCAGGATGATGATGAAACAAGCCAAGTCCAACCCCATCAATCTCTCCCATGATATTGTGCCACGTGTTGTCCCTTGGATGCATGATTCTATCCAGAAATATGGTAAGAATTTTTTCATATGGTTTGGGCCAGTACCAAGGGTGCACATAATGGAGCCAGAATTAATAAGGGAGATATTGAATAAGCATCAGATCTTCCAGAAGCCTAAGTCACATCCGTTAGTGAAGTTGTTAGCAAATGGACTGGCAAGCCATGAGGAGGAAAAGTGGGCCAAACACAGGAAAATTATCAACCCTGCTTTCCATGTTGAGAAGTTAAAGGTTTTTTTTATAACCTATTTCCTCTTTAATATTTTGATTTTTAGTGCTTCTTAA

Network for GWHGAAZE001869

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	90	166	6.80E-10
PF01743.21	PolyA_pol	101	135	1.90E-08
PF12627.8	PolyA_pol_RNAbd	159	220	8.80E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0006396	biological_process	RNA processing
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding
GO:0003723	molecular_function	RNA binding
GO:0016779	molecular_function	nucleotidyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.175
	SRR3591706	second leaf	0.479
	SRR3591707	mature leaf	2.321
	SRR3591708	Shoot apex	0.663
	SRR3591709	Stem	1.206
	SRR3591710	White floral bud	1.949
	SRR3591711	White flower	1.103
	SRR3591712	Green floral bud	0.561
	SRR3591713	Yellow flower	2.272
SRP173429	SRR8316895	Juvenile bud stage	0.013
	SRR8316896	Juvenile bud stage	0.035
	SRR8316897	Juvenile bud stage	0.193
	SRR8316894	Third green stage	0.037
	SRR8316900	Third green stage	0.069
	SRR8316901	Third green stage	0.095
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.163
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.054
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.031
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.024
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.016
	CNS0095597	Whole white alabastrum(diploid) 4	0.069
	CNS0095598	Silvery flower (diploied) 1	0.023
	CNS0095599	Silvery flower (diploied) 2	0.127
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.108
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.081
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.108
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.157
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.015
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.301
	CNS0095611	Silvery flower (tetraploid) 2	0.463
	CNS0095612	Silvery flower (tetraploid) 3	0.062
	CNS0095613	Golden flower (tetraploid) 1	0.110
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.021
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.045
	CRR073301	Leaf 2	0.010
	CRR073302	Leaf 3	0.016
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.011
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.005
	CRR073307	Third green 2	0.013
	CRR073308	Third green 3	0.043
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.019
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.315
	CRR073318	Tawny withering 1	1.677
	CRR073319	Tawny withering 2	0.879
	CRR073320	Tawny withering 3	0.117