Gene detail

Detail information of GWHGAAZE001864

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	H2DH21.1C7A29_PANGI	1.47364E-60	RecName: Full=Cytochrome P450 CYP72A219; AltName: Full=Cytochrome P450 CYP72A129 [Panax ginseng]
COG	YP_001522424.1	0.0000005	cytochrome P450 family protein
Swissprot	tr\|H2DH21\|C7A29_PANGI	7E-63	Cytochrome P450 CYP72A219
trEMBL	tr\|A0A022QUQ9\|A0A022QUQ9_ERYGU	4E-60	Uncharacterized protein {ECO:0000313\|EMBL:EYU31636.1}
TAIR10	AT3G14690.1	5E-43	cytochrome P450, family 72, subfamily A, polypeptide 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63124759	63127674	-
GWHAAZE00000001	mRNA	63124759	63127674	-
GWHAAZE00000001	exon	63127392	63127674	-
GWHAAZE00000001	exon	63124759	63125030	-
GWHAAZE00000001	CDS	63127392	63127674	-
GWHAAZE00000001	CDS	63124759	63125030	-

Transcript Sequence
>GWHTAAZE001868 ATGGATGCAATATTAGTACTGTACAACTCAGTTGCAGCTTGCTGTGCTATAGCAATTGTACTCTGGGCATGGAGGATATTTGATTGGGTGTGGGTGAGGCCAATGAAGAGAGACAAATACCTCAGAAATCAAGGCTTCAAGGGAAGCTCTTACAACTTTTTCTTTGGAGATGTCAAAAGGATCAGGATGATGATCGAACAAGCCAAGTCCAACCCCATCAATCTCTCCCATGATATTGTTCCACGTGTTGTCCCTTGGATGCATGATTCTATCCAGAAATATGGTAAGAATTTTTTCATATGGTTTGGGCCAGTACCAAGGGTGCACATAATGGAGCCAGAATTAATAAGGGAGATACTGAATAAGCATCAGATCTTCCAGAAGCCTAAGTCACATCCGTTAGTGAAGTTGTTAGCAAATGGACTGGCAAGCCATGAGGAGGAAAAGTGGGCCAAACACAGGAAAATTATCAACCCTGCTTTCCATGTTGAGAAGTTGAAGGTTTTTTTTATAACCTATTTCCTCTTTAATATTTTGATTTTTAATGCTTCTTAA

Network for GWHGAAZE001864

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	90	166	7.20E-10
PF17766.2	fn3_6	40	142	1.30E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.691
	SRR3591706	second leaf	0.844
	SRR3591707	mature leaf	1.225
	SRR3591708	Shoot apex	1.177
	SRR3591709	Stem	1.292
	SRR3591710	White floral bud	0.737
	SRR3591711	White flower	1.135
	SRR3591712	Green floral bud	0.937
	SRR3591713	Yellow flower	0.861
SRP173429	SRR8316895	Juvenile bud stage	0.097
	SRR8316896	Juvenile bud stage	0.530
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.284
	SRR8316900	Third green stage	0.444
	SRR8316901	Third green stage	1.539
	SRR8316898	Complete white stage	1.373
	SRR8316899	Complete white stage	2.999
	SRR8316903	Complete white stage	1.908
	SRR8316902	Silver flowering stage	0.343
	SRR8316904	Silver flowering stage	0.129
	SRR8316905	Silver flowering stage	0.162
	SRR8316906	Gold flowering stage	0.373
	SRR8316907	Gold flowering stage	0.339
	SRR8316908	Gold flowering stage	0.045
SRP132670	SRR6706286	Control	0.742
	SRR6706287	Light intensity 50%	1.245
	SRR6706288	Light intensity 20%	1.584
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.739
	CNS0095593	Slightly white alabastrum(diploid) 2	0.612
	CNS0095594	Slightly white alabastrum(diploid) 3	0.957
	CNS0095595	Whole white alabastrum(diploid) 2	0.354
	CNS0095596	Whole white alabastrum(diploid) 3	0.970
	CNS0095597	Whole white alabastrum(diploid) 4	0.987
	CNS0095598	Silvery flower (diploied) 1	1.608
	CNS0095599	Silvery flower (diploied) 2	0.818
	CNS0095600	Silvery flower (diploied) 3	1.847
	CNS0095601	Golden flower (diploid) 1	1.326
	CNS0095602	Golden flower (diploid) 2	2.354
	CNS0095603	Golden flower (diploid) 3	1.877
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.143
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.709
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.083
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.016
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.074
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.248
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.051
CRA001975	CRR073297	Stem 1	0.311
	CRR073298	Stem 2	0.115
	CRR073299	Stem 3	1.114
	CRR073300	Leaf 1	2.306
	CRR073301	Leaf 2	1.071
	CRR073302	Leaf 3	1.362
	CRR073303	Juvenile bud 1	1.129
	CRR073304	Juvenile bud 2	10.212
	CRR073305	Juvenile bud 3	0.999
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.036
	CRR073308	Third green 3	0.212
	CRR073309	Second white 1	0.214
	CRR073310	Second white 2	0.244
	CRR073311	Second white 3	0.133
	CRR073312	Silver flowering 1	0.099
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.471
	CRR073315	Gold flowering 1	2.970
	CRR073316	Gold flowering 2	2.521
	CRR073317	Gold flowering 3	1.358
	CRR073318	Tawny withering 1	2.037
	CRR073319	Tawny withering 2	1.000
	CRR073320	Tawny withering 3	0.283