Gene detail

Detail information of GWHGAAZE001839

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002302146.2	1.97776E-14	xyloglucan endo-1 family protein [Populus trichocarpa]
Swissprot	tr\|P35694\|XTH2_SOYBN	4E-12	Xyloglucan endotransglucosylase/hydrolase 2 {ECO:0000250\|UniProtKB:Q38857} (Precursor)
trEMBL	tr\|B9GT42\|B9GT42_POPTR	7E-15	Xyloglucan endotransglucosylase/hydrolase {ECO:0000256\|RuleBase:RU361120}
TAIR10	AT5G57560.1	6E-10	Xyloglucan endotransglucosylase/hydrolase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	62327913	62328993	-
GWHAAZE00000001	mRNA	62327913	62328993	-
GWHAAZE00000001	exon	62327913	62328035	-
GWHAAZE00000001	exon	62328163	62328289	-
GWHAAZE00000001	exon	62328779	62328993	-
GWHAAZE00000001	CDS	62328779	62328993	-
GWHAAZE00000001	CDS	62328163	62328289	-
GWHAAZE00000001	CDS	62327913	62328035	-

Transcript Sequence
>GWHTAAZE001843 ATGTTGTTCTTCTCTTGTTCAAAAGCCTCAGCAATGCTTCTACCTTGCATATTTTTGGCATATCTAGTTGCTTCCTCATCTGCAAATTTCTATCAAGACGCTCAAATCACATGGGGTGATCAACGCGCTAAGATACTCAACGGCGGTCAGCTTCTTACTCTATCTTTAGACCAGGCTTCGGAGCCGGGTTTCATCCAAGAAGGAATACCTATTCGTTTTTGGTGGACAATATTCCCATTAGAGTATTTCACAACAGTGAAGCAATCGGATTCCATTCCCAAAGAATCAACCCATGAGGGTGTATGCGAGCCTTTGGAATGCCTGATGACTGGGCAACACAAGAGGCATGGCAAACTCAAGAACTTGATGGTGCCTGGACGTAATAGACTTCGGTGGGTACAAGCAAAGCACATGATCTACAACTATCGCAATGACATCAAACGCTTTTCTCGGGTCTTCCTCTGA

Network for GWHGAAZE001839

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06955.13	XET_C	121	151	4.10E-08
PF00069.26	Pkinase	9	272	7.00E-64
PF03822.15	NAF	315	373	2.00E-18

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CAMK_CAMKL-CHK1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0007165	biological_process	signal transduction
GO:0006073	biological_process	cellular glucan metabolic process
GO:0005618	cellular_component	cell wall
GO:0048046	cellular_component	apoplast
GO:0005524	molecular_function	ATP binding
GO:0004672	molecular_function	protein kinase activity
GO:0016762	molecular_function	xyloglucan:xyloglucosyl transferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.953
	SRR3591706	second leaf	0.061
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.104
	SRR3591709	Stem	3.648
	SRR3591710	White floral bud	0.281
	SRR3591711	White flower	0.606
	SRR3591712	Green floral bud	0.135
	SRR3591713	Yellow flower	0.805
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	4.627
	SRR8316894	Third green stage	0.119
	SRR8316900	Third green stage	0.093
	SRR8316901	Third green stage	0.080
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.036
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.023
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	1.254
SRP132670	SRR6706286	Control	0.018
	SRR6706287	Light intensity 50%	0.060
	SRR6706288	Light intensity 20%	0.015
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.006
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.150
	CNS0095600	Silvery flower (diploied) 3	0.050
	CNS0095601	Golden flower (diploid) 1	0.055
	CNS0095602	Golden flower (diploid) 2	0.125
	CNS0095603	Golden flower (diploid) 3	0.022
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.189
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.244
	CNS0095613	Golden flower (tetraploid) 1	0.443
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.083
	CRR073301	Leaf 2	0.169
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.065
	CRR073305	Juvenile bud 3	0.123
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.139
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.113
	CRR073312	Silver flowering 1	0.275
	CRR073313	Silver flowering 2	0.075
	CRR073314	Silver flowering 3	0.220
	CRR073315	Gold flowering 1	0.085
	CRR073316	Gold flowering 2	0.036
	CRR073317	Gold flowering 3	0.122
	CRR073318	Tawny withering 1	0.084
	CRR073319	Tawny withering 2	0.060
	CRR073320	Tawny withering 3	0.000