Gene detail

Detail information of GWHGAAZE001740

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009617142.1	4.40913E-23	PREDICTED: F-box/kelch-repeat protein At3g06240-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9SFC7\|FB135_ARATH	0.00000001	F-box protein At3g07870
trEMBL	tr\|A0A068V613\|A0A068V613_COFCA	4E-21	Coffea canephora DH200=94 genomic scaffold, scaffold_112 {ECO:0000313\|EMBL:CDP15969.1}
TAIR10	AT3G07870.1	0.0000001	F-box and associated interaction domains-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	59261255	59261530	-
GWHAAZE00000001	mRNA	59261255	59261530	-
GWHAAZE00000001	exon	59261255	59261530	-
GWHAAZE00000001	CDS	59261255	59261530	-

Transcript Sequence
>GWHTAAZE001744 ATGCTTTCAGTTTGGGTCATGAAAGAATACGGTGTGGTCGAGTCTTGGACCAAGCAATATAATATTGATACAGAGGTGGGTTTGGGAATAATGCTTGGTGTTCGGAGGAACGGTGAAGTACTATTGACAACAAGAAATGAAGAGCTGGTTGAATATGATGTGCAGACCCGAGGAAGCATGGACCTTATCACTTATGGGATGAAGAACTCTTTTTTTGTGGATACTTATAAGGAGAGCTTCGCTTTACTCTTTGAAGGTGAAAAAACCCACGTATAA

Network for GWHGAAZE001740

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	93	231	1.10E-25
PF07714.18	PK_Tyr_Ser-Thr	242	342	7.80E-07

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIIa-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.527
	SRR3591706	second leaf	11.117
	SRR3591707	mature leaf	13.368
	SRR3591708	Shoot apex	22.047
	SRR3591709	Stem	11.307
	SRR3591710	White floral bud	12.997
	SRR3591711	White flower	13.683
	SRR3591712	Green floral bud	13.635
	SRR3591713	Yellow flower	8.542
SRP173429	SRR8316895	Juvenile bud stage	7.986
	SRR8316896	Juvenile bud stage	11.832
	SRR8316897	Juvenile bud stage	5.823
	SRR8316894	Third green stage	3.736
	SRR8316900	Third green stage	12.752
	SRR8316901	Third green stage	15.596
	SRR8316898	Complete white stage	6.645
	SRR8316899	Complete white stage	18.435
	SRR8316903	Complete white stage	7.678
	SRR8316902	Silver flowering stage	5.532
	SRR8316904	Silver flowering stage	5.885
	SRR8316905	Silver flowering stage	4.863
	SRR8316906	Gold flowering stage	11.225
	SRR8316907	Gold flowering stage	18.770
	SRR8316908	Gold flowering stage	13.980
SRP132670	SRR6706286	Control	7.415
	SRR6706287	Light intensity 50%	6.810
	SRR6706288	Light intensity 20%	7.931
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.732
	CNS0095593	Slightly white alabastrum(diploid) 2	22.969
	CNS0095594	Slightly white alabastrum(diploid) 3	15.583
	CNS0095595	Whole white alabastrum(diploid) 2	15.365
	CNS0095596	Whole white alabastrum(diploid) 3	12.771
	CNS0095597	Whole white alabastrum(diploid) 4	13.053
	CNS0095598	Silvery flower (diploied) 1	22.037
	CNS0095599	Silvery flower (diploied) 2	11.569
	CNS0095600	Silvery flower (diploied) 3	8.984
	CNS0095601	Golden flower (diploid) 1	22.626
	CNS0095602	Golden flower (diploid) 2	13.907
	CNS0095603	Golden flower (diploid) 3	11.832
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.792
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.511
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.966
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.533
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.948
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.663
	CNS0095610	Silvery flower (tetraploid) 1	13.501
	CNS0095611	Silvery flower (tetraploid) 2	9.679
	CNS0095612	Silvery flower (tetraploid) 3	8.161
	CNS0095613	Golden flower (tetraploid) 1	8.298
	CNS0095614	Golden flower (tetraploid) 2	10.306
	CNS0095615	Golden flower (tetraploid) 3	7.179
CRA001975	CRR073297	Stem 1	9.321
	CRR073298	Stem 2	7.660
	CRR073299	Stem 3	4.112
	CRR073300	Leaf 1	7.740
	CRR073301	Leaf 2	6.137
	CRR073302	Leaf 3	4.093
	CRR073303	Juvenile bud 1	5.556
	CRR073304	Juvenile bud 2	1.677
	CRR073305	Juvenile bud 3	7.527
	CRR073306	Third green 1	1.989
	CRR073307	Third green 2	1.233
	CRR073308	Third green 3	2.660
	CRR073309	Second white 1	3.358
	CRR073310	Second white 2	1.402
	CRR073311	Second white 3	0.699
	CRR073312	Silver flowering 1	2.188
	CRR073313	Silver flowering 2	1.844
	CRR073314	Silver flowering 3	0.592
	CRR073315	Gold flowering 1	7.320
	CRR073316	Gold flowering 2	6.448
	CRR073317	Gold flowering 3	2.144
	CRR073318	Tawny withering 1	5.534
	CRR073319	Tawny withering 2	5.526
	CRR073320	Tawny withering 3	7.550