Gene detail

Detail information of GWHGAAZE001705

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP14239.1	3.71347E-10	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068V181\|A0A068V181_COFCA	1E-10	Coffea canephora DH200=94 genomic scaffold, scaffold_81 {ECO:0000313\|EMBL:CDP14239.1}

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	58387738	58388902	+
GWHAAZE00000001	mRNA	58387738	58388902	+
GWHAAZE00000001	exon	58387738	58387850	+
GWHAAZE00000001	exon	58388029	58388355	+
GWHAAZE00000001	exon	58388480	58388558	+
GWHAAZE00000001	exon	58388726	58388902	+
GWHAAZE00000001	CDS	58387738	58387850	+
GWHAAZE00000001	CDS	58388029	58388355	+
GWHAAZE00000001	CDS	58388480	58388558	+
GWHAAZE00000001	CDS	58388726	58388902	+

Transcript Sequence
>GWHTAAZE001709 ATGGCTAAGAGATCCTACACAGACATGGAGTCATCTTCAGGGTTGATACCCTGGTCTCGAAAGGCGTGGGGTCAATCAAGAGGGCAAGGGACCTTGGGACCCACATTCTATTGGGAAAAATCCTTGGCCGATATGATTGGTGGTTCAAGATCTACGGCTAGTATTCAACTTTGGGATCCGGATATATACAAAGGTGAACCAACAATCTTCTTCTTTGATGAATATATTGCTAAGCTTTCCTTTCCATTTCAATTTGCCCTCATAGGAAACTTCTCGCATCATACACCTTTGCTACCTCAGATTTGCTCAGTTTTTGAAATGTATGGTCTCAAATCAGCAATCAACATTGGGCTTTTGGATAGTAAGCACATCCAAATAAAATTCAAAATTTCAAACATGAAGATAATTATCACTGGATATGTTCACGGGATTACTGGTTTACATTGGGGCAAAACATTGGGTAATCCAACGGAGATGGATGCTGCTACAGCAATGTTAACTCATCCTAATGTTGCTAGACATCAACGCCATGAGCAATGGATCCAAAAGCAGCACGAAGATAACAGGGAAGGGAAAAACGTTAGTATTAAAGATCCAGTGGATGCGGATGAATTCAAAAGCAAACCATGGGCTCAAGAAGCAATATCAGAGATTCCTGTATTTCATAACGTAAATCTAGATGAAGGGAGTCATTAA

Network for GWHGAAZE001705

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	135	407	6.80E-48
PF07714.18	PK_Tyr_Ser-Thr	520	716	1.30E-17

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding
GO:0004674	molecular_function	protein serine/threonine kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.665
	SRR3591706	second leaf	0.056
	SRR3591707	mature leaf	0.201
	SRR3591708	Shoot apex	0.192
	SRR3591709	Stem	0.271
	SRR3591710	White floral bud	0.223
	SRR3591711	White flower	2.941
	SRR3591712	Green floral bud	0.540
	SRR3591713	Yellow flower	3.308
SRP173429	SRR8316895	Juvenile bud stage	0.183
	SRR8316896	Juvenile bud stage	0.327
	SRR8316897	Juvenile bud stage	0.084
	SRR8316894	Third green stage	0.301
	SRR8316900	Third green stage	0.375
	SRR8316901	Third green stage	0.359
	SRR8316898	Complete white stage	0.182
	SRR8316899	Complete white stage	0.607
	SRR8316903	Complete white stage	0.410
	SRR8316902	Silver flowering stage	0.671
	SRR8316904	Silver flowering stage	0.834
	SRR8316905	Silver flowering stage	0.234
	SRR8316906	Gold flowering stage	0.678
	SRR8316907	Gold flowering stage	0.991
	SRR8316908	Gold flowering stage	0.909
SRP132670	SRR6706286	Control	0.122
	SRR6706287	Light intensity 50%	0.149
	SRR6706288	Light intensity 20%	0.111
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.238
	CNS0095593	Slightly white alabastrum(diploid) 2	0.020
	CNS0095594	Slightly white alabastrum(diploid) 3	0.052
	CNS0095595	Whole white alabastrum(diploid) 2	0.125
	CNS0095596	Whole white alabastrum(diploid) 3	0.188
	CNS0095597	Whole white alabastrum(diploid) 4	1.020
	CNS0095598	Silvery flower (diploied) 1	0.277
	CNS0095599	Silvery flower (diploied) 2	0.713
	CNS0095600	Silvery flower (diploied) 3	1.196
	CNS0095601	Golden flower (diploid) 1	0.230
	CNS0095602	Golden flower (diploid) 2	1.547
	CNS0095603	Golden flower (diploid) 3	2.045
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.161
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.202
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.362
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.189
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.127
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.167
	CNS0095610	Silvery flower (tetraploid) 1	0.724
	CNS0095611	Silvery flower (tetraploid) 2	0.138
	CNS0095612	Silvery flower (tetraploid) 3	0.320
	CNS0095613	Golden flower (tetraploid) 1	0.099
	CNS0095614	Golden flower (tetraploid) 2	0.487
	CNS0095615	Golden flower (tetraploid) 3	0.982
CRA001975	CRR073297	Stem 1	0.283
	CRR073298	Stem 2	0.189
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.676
	CRR073301	Leaf 2	0.124
	CRR073302	Leaf 3	0.043
	CRR073303	Juvenile bud 1	0.329
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.329
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.058
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.045
	CRR073319	Tawny withering 2	0.096
	CRR073320	Tawny withering 3	0.388