Gene detail

Detail information of GWHGAAZE001681

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU30756.1	1.71651E-27	hypothetical protein MIMGU_mgv1a018041mg [Erythranthe guttata]
Swissprot	tr\|Q9SU30\|CPR30_ARATH	4E-13	F-box protein CPR30
trEMBL	tr\|A0A022QS53\|A0A022QS53_ERYGU	6E-28	Uncharacterized protein {ECO:0000313\|EMBL:EYU30756.1}
TAIR10	AT4G12560.2	6E-12	F-box and associated interaction domains-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	57714782	57715375	-
GWHAAZE00000001	mRNA	57714782	57715375	-
GWHAAZE00000001	exon	57714782	57715375	-
GWHAAZE00000001	CDS	57714782	57715375	-

Transcript Sequence
>GWHTAAZE001685 ATGTCTGACTATATTCCTACTGAAATCATAGTTAATATCCTCTCCTGGCTGCCTCCGAGGTCTCTTCTTCGATTCAGGTGCGTATGTAAGTCATGGTGTTCTCTAATTTCAAGCCCTAATTTCATCGACATTCATACTCACCAACTCGATGCTTCTTGGAATCACAATACTCGCTTACTCGCCATGCGATGGACTGGCCGTGCAAGTTACGGTAGCAAAGTCTATCCTCTCGATTTCGATAGCGAAATTTTAAGCGTAGACGTCGAGAGTGTTGGAATTGATTGCCCATTTCCCATTCCAGCACAGTGCTGCTGCACTTCTTGTAATGGCTTGTTTCTTGTTCGTTGTTCCGTCTTTCAAGGTCTATGGAATCCTTCCATTAGAAGAAAACTGGTTCTCGGCGAGTCCCTATTGGGGTTCGACGTGAAACGTAGCTATTTTAGTGCATTGGGTTTTAATCCAAAAACTAATGATTACAAGGTTGTCAATATTGGATATGAACGAATGGGCGATGGATCCCATTGTAGTGAAGTTAGGGTTTATTCAGTTAAGGAGGGGTCTTGGAGGCGCATTAGTGCCCTGCTCTTGCTATGA

Network for GWHGAAZE001681

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	6	41	7.80E-11
PF01095.20	Pectinesterase	53	349	5.50E-143

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
K01051	E3.1.1.11	Metabolic pathways	map01100
		Pentose and glucuronate interconversions	map00040
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0042545	biological_process	cell wall modification
GO:0030599	molecular_function	pectinesterase activity
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.504
	SRR3591706	second leaf	0.645
	SRR3591707	mature leaf	0.393
	SRR3591708	Shoot apex	1.662
	SRR3591709	Stem	0.714
	SRR3591710	White floral bud	1.240
	SRR3591711	White flower	1.173
	SRR3591712	Green floral bud	2.688
	SRR3591713	Yellow flower	0.170
SRP173429	SRR8316895	Juvenile bud stage	0.032
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.750
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.048
	SRR8316901	Third green stage	0.019
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.074
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.027
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.245
SRP132670	SRR6706286	Control	0.007
	SRR6706287	Light intensity 50%	0.007
	SRR6706288	Light intensity 20%	0.008
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.064
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.022
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.025
	CNS0095602	Golden flower (diploid) 2	0.128
	CNS0095603	Golden flower (diploid) 3	0.056
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.101
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.425
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.713
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.703
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.572
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.116
	CNS0095610	Silvery flower (tetraploid) 1	0.334
	CNS0095611	Silvery flower (tetraploid) 2	2.231
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.113
	CNS0095614	Golden flower (tetraploid) 2	0.515
	CNS0095615	Golden flower (tetraploid) 3	0.260
CRA001975	CRR073297	Stem 1	0.345
	CRR073298	Stem 2	0.084
	CRR073299	Stem 3	0.083
	CRR073300	Leaf 1	0.241
	CRR073301	Leaf 2	0.277
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.018
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.025
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.010
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.057
	CRR073317	Gold flowering 3	0.010
	CRR073318	Tawny withering 1	0.493
	CRR073319	Tawny withering 2	0.171
	CRR073320	Tawny withering 3	0.387