Gene detail

Detail information of GWHGAAZE001680

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011098049.1	2.56897E-25	PREDICTED: F-box protein At3g07870-like [Sesamum indicum]
Swissprot	tr\|Q9SFC7\|FB135_ARATH	0.00000003	F-box protein At3g07870
trEMBL	tr\|A0A068V5X4\|A0A068V5X4_COFCA	1E-24	Coffea canephora DH200=94 genomic scaffold, scaffold_112 {ECO:0000313\|EMBL:CDP15967.1}
TAIR10	AT3G07870.1	0.0000002	F-box and associated interaction domains-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	57667961	57668419	-
GWHAAZE00000001	mRNA	57667961	57668419	-
GWHAAZE00000001	exon	57667961	57668419	-
GWHAAZE00000001	CDS	57667961	57668419	-

Transcript Sequence
>GWHTAAZE001684 ATGGTGTTTGATACGGTTGAAGAGGTATTTCGCGAGATAATGTTGCCGAAAAGTTTAGTGTCCATAGCAACTCACAACTTGTATCCCATGGTAATTGGGGGTTCACTTTCAGTCATTCAATATGAAAAATATCTCAACCTTCGTTCCATTTGGGTGATGAAAAAATATGGTGTGGTAGAGTCGTGGAGTAAAAAATATAGTTTTGATTCTGGCATGGGTTTTGGGAAGTTGTTGGGTTTTAGGGAGAATGGCGAACTGGTATTAGTGAATAAAGATGATGATCTGGTAGCTTATAACCCGATTACCCGACAAAGCACCAACCTTACGGCCGGCTGCCATAATAACTTCTATTATCGCGATACCTACAAGGAGAGCTTAGGATTACTCCTCGAAGGAGAACAAATTTCAGCAATACAAACAAGTGACGTCGAACCTATTTCATCTGGAGAGGAGGACTGA

Network for GWHGAAZE001680

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02727.17	Cu_amine_oxidN2	25	111	4.90E-19
PF02728.17	Cu_amine_oxidN3	119	213	5.10E-18
PF01179.21	Cu_amine_oxid	240	656	4.90E-134

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00276	AOC3, AOC2, tynA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Glycine, serine and threonine metabolism	map00260
		Tyrosine metabolism	map00350
		Phenylalanine metabolism	map00360
		beta-Alanine metabolism	map00410
		Isoquinoline alkaloid biosynthesis	map00950
		Tropane, piperidine and pyridine alkaloid biosynthesis	map00960

Gene Ontology

GO term	Ontology	Name
GO:0009308	biological_process	amine metabolic process
GO:0055114	biological_process	oxidation-reduction process
GO:0005507	molecular_function	copper ion binding
GO:0008131	molecular_function	primary amine oxidase activity
GO:0048038	molecular_function	quinone binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.644
	SRR3591706	second leaf	0.915
	SRR3591707	mature leaf	0.181
	SRR3591708	Shoot apex	1.667
	SRR3591709	Stem	1.059
	SRR3591710	White floral bud	0.144
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.119
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.199
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.190
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.096
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.006
	SRR6706288	Light intensity 20%	0.117
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.106
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.253
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.055
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.108
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.021
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.480
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.368
	CRR073298	Stem 2	0.021
	CRR073299	Stem 3	0.232
	CRR073300	Leaf 1	0.130
	CRR073301	Leaf 2	0.099
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.249
	CRR073304	Juvenile bud 2	0.016
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.008
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.016
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.335
	CRR073316	Gold flowering 2	0.018
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.113
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000