Gene detail

Detail information of GWHGAAZE001352

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004486969.1	6.80064E-37	PREDICTED: transcription factor MYB46-like [Cicer arietinum]
Swissprot	tr\|Q9LXV2\|MYB46_ARATH	6E-36	Transcription factor MYB46
trEMBL	tr\|A0A067JRD5\|A0A067JRD5_JATCU	3E-37	Uncharacterized protein {ECO:0000313\|EMBL:KDP22089.1}
TAIR10	AT5G12870.1	1E-29	myb domain protein 46

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	33198034	33198222	-
GWHAAZE00000001	mRNA	33198034	33198222	-
GWHAAZE00000001	exon	33198034	33198222	-
GWHAAZE00000001	CDS	33198034	33198222	-

Transcript Sequence
>GWHTAAZE001356 ATGAATTACATGGTGAGCAACGGACAAGGGTGTTGGACCGACGTTGCTAGAAATGCCGGCCTTCAGAGGTGCGGTAAGAGCTGCAGACTGAGATGGATAAACTACTTGAGGCCTGACCTCAAGAGAGGTGCCTTTTCCCCTCAAGAGGAACAACTCATCATCCATCTCCATTCCCTCCTTGGCAACAGG

Network for GWHGAAZE001352

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13921.7	Myb_DNA-bind_6	8	52	2.90E-08

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB-related

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	30.633
	SRR3591706	second leaf	1.402
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	2.317
	SRR3591709	Stem	31.026
	SRR3591710	White floral bud	1.045
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	1.599
	SRR3591713	Yellow flower	0.159
SRP173429	SRR8316895	Juvenile bud stage	8.760
	SRR8316896	Juvenile bud stage	5.649
	SRR8316897	Juvenile bud stage	1.953
	SRR8316894	Third green stage	0.488
	SRR8316900	Third green stage	1.564
	SRR8316901	Third green stage	1.959
	SRR8316898	Complete white stage	0.258
	SRR8316899	Complete white stage	0.517
	SRR8316903	Complete white stage	0.254
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.289
	SRR6706287	Light intensity 50%	1.154
	SRR6706288	Light intensity 20%	0.548
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.557
	CNS0095593	Slightly white alabastrum(diploid) 2	0.417
	CNS0095594	Slightly white alabastrum(diploid) 3	1.696
	CNS0095595	Whole white alabastrum(diploid) 2	0.051
	CNS0095596	Whole white alabastrum(diploid) 3	0.235
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.429
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.614
	CNS0095601	Golden flower (diploid) 1	0.018
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.179
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.710
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.184
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.124
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.976
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.392
CRA001975	CRR073297	Stem 1	20.782
	CRR073298	Stem 2	12.911
	CRR073299	Stem 3	17.429
	CRR073300	Leaf 1	0.447
	CRR073301	Leaf 2	1.632
	CRR073302	Leaf 3	3.600
	CRR073303	Juvenile bud 1	0.167
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.197
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.473
	CRR073317	Gold flowering 3	0.360
	CRR073318	Tawny withering 1	13.490
	CRR073319	Tawny withering 2	3.433
	CRR073320	Tawny withering 3	34.222