Gene detail

Detail information of GWHGAAZE001319

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011090146.1	3.34838E-69	PREDICTED: ubiquitin carboxyl-terminal hydrolase 24-like [Sesamum indicum]
Swissprot	tr\|Q9FPS3\|UBP24_ARATH	1E-39	Ubiquitin carboxyl-terminal hydrolase 24
trEMBL	tr\|M1B0G0\|M1B0G0_SOLTU	1E-66	Ubiquitin carboxyl-terminal hydrolase {ECO:0000256\|RuleBase:RU004435}
TAIR10	AT4G30890.3	3E-35	ubiquitin-specific protease 24

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	31785887	31786754	-
GWHAAZE00000001	mRNA	31785887	31786754	-
GWHAAZE00000001	exon	31785887	31786081	-
GWHAAZE00000001	exon	31786170	31786754	-
GWHAAZE00000001	CDS	31786170	31786754	-
GWHAAZE00000001	CDS	31785887	31786081	-

Transcript Sequence
>GWHTAAZE001323 TTTGCTTTTGGTTTACCATTTATAATTGCTTATCACTGGCAGGTATTGGTGTTTGGTTCATTTACAGACCATGAAATCAAGTCCCTGCAAACACAACCAACAGAGAACGACGTAGAAATTACATTTGGTTCACTGGACTCCGCTACTCTAAGATCTGTTGGCATATTCAATACTAAACCAATAGAGCTTGAATGTTCTAAGCCAGGTAATGGAAATAATGCTGTCAATAGTCCGAAAGAAATAAAATCACCAATACTGTCAGTGCCGTGCTTATCTGGCAATGTTTGTGATCCTCCAAACCAGTGTAGTCCAAAACAGAATGCGACTGAAGATGTGAATATATCATCTGAACCTCTAGCAACTGAAGCCTCAGTTAGTTCATCAGAAATTTTGGATCTTGTGGATTCCAAAGAAAATACTTTAACGGCATCAAATGAGCCAAGTGTGGCTGTCAGAAATTTACTACCTCGAGGTTTAGTTAACTCGGGAAATTTGTGCTTTCTAAATGCAACTCTGCAGGCTCTTATATCTTGTTCTCCATTCGTTCAACTCTTGCAGGAACTAAGAACTTGTAATATACCAGAGATCGAGTATCCAACCCTATGTGCCTTTGTGGAGTTTATCTCTGACTTTGACATGCTTCTTGATTCAAGATCAAAGAAATGCGAGGCAGTTCTGGAAACTGGGAGGCCTTTGCACCCTGTCATGTTTGAATCTGTTCTGAAAAATTTCTCCCCTGATGTGCCAGATAGCTTATCTGGCCGGCCAAGGTTTGCCTAG

Network for GWHGAAZE001319

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00443.30	UCH	157	196	4.60E-07

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	USP

KEGG pathway

KO	Enzyme	pathway	mapID
K11841	USP10, UBP3	Mitophagy - yeast	map04139

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process
GO:0016579	biological_process	protein deubiquitination
GO:0036459	molecular_function	thiol-dependent ubiquitinyl hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.809
	SRR3591706	second leaf	2.423
	SRR3591707	mature leaf	3.654
	SRR3591708	Shoot apex	8.176
	SRR3591709	Stem	14.853
	SRR3591710	White floral bud	6.142
	SRR3591711	White flower	5.078
	SRR3591712	Green floral bud	5.707
	SRR3591713	Yellow flower	1.335
SRP173429	SRR8316895	Juvenile bud stage	5.143
	SRR8316896	Juvenile bud stage	3.940
	SRR8316897	Juvenile bud stage	1.701
	SRR8316894	Third green stage	2.490
	SRR8316900	Third green stage	3.900
	SRR8316901	Third green stage	3.801
	SRR8316898	Complete white stage	0.607
	SRR8316899	Complete white stage	5.702
	SRR8316903	Complete white stage	2.961
	SRR8316902	Silver flowering stage	0.316
	SRR8316904	Silver flowering stage	0.776
	SRR8316905	Silver flowering stage	0.350
	SRR8316906	Gold flowering stage	0.566
	SRR8316907	Gold flowering stage	0.765
	SRR8316908	Gold flowering stage	0.804
SRP132670	SRR6706286	Control	3.002
	SRR6706287	Light intensity 50%	3.238
	SRR6706288	Light intensity 20%	2.923
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.126
	CNS0095593	Slightly white alabastrum(diploid) 2	4.313
	CNS0095594	Slightly white alabastrum(diploid) 3	3.567
	CNS0095595	Whole white alabastrum(diploid) 2	3.083
	CNS0095596	Whole white alabastrum(diploid) 3	2.270
	CNS0095597	Whole white alabastrum(diploid) 4	3.267
	CNS0095598	Silvery flower (diploied) 1	7.214
	CNS0095599	Silvery flower (diploied) 2	3.817
	CNS0095600	Silvery flower (diploied) 3	3.188
	CNS0095601	Golden flower (diploid) 1	6.571
	CNS0095602	Golden flower (diploid) 2	4.870
	CNS0095603	Golden flower (diploid) 3	5.242
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.281
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.588
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.629
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.561
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.131
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.310
	CNS0095610	Silvery flower (tetraploid) 1	1.496
	CNS0095611	Silvery flower (tetraploid) 2	4.013
	CNS0095612	Silvery flower (tetraploid) 3	3.579
	CNS0095613	Golden flower (tetraploid) 1	0.258
	CNS0095614	Golden flower (tetraploid) 2	1.166
	CNS0095615	Golden flower (tetraploid) 3	0.116
CRA001975	CRR073297	Stem 1	4.307
	CRR073298	Stem 2	3.558
	CRR073299	Stem 3	5.034
	CRR073300	Leaf 1	2.220
	CRR073301	Leaf 2	1.378
	CRR073302	Leaf 3	1.894
	CRR073303	Juvenile bud 1	2.277
	CRR073304	Juvenile bud 2	1.626
	CRR073305	Juvenile bud 3	2.129
	CRR073306	Third green 1	0.414
	CRR073307	Third green 2	0.216
	CRR073308	Third green 3	0.131
	CRR073309	Second white 1	0.641
	CRR073310	Second white 2	1.298
	CRR073311	Second white 3	0.328
	CRR073312	Silver flowering 1	0.467
	CRR073313	Silver flowering 2	0.089
	CRR073314	Silver flowering 3	0.184
	CRR073315	Gold flowering 1	2.473
	CRR073316	Gold flowering 2	5.188
	CRR073317	Gold flowering 3	5.456
	CRR073318	Tawny withering 1	7.710
	CRR073319	Tawny withering 2	9.922
	CRR073320	Tawny withering 3	10.619