Gene detail

Detail information of GWHGAAZE001127

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006362874.1	1.98322E-71	PREDICTED: NAC domain-containing protein 90-like [Solanum tuberosum]
Swissprot	tr\|Q9FMR3\|NAC90_ARATH	2E-62	NAC domain-containing protein 90
trEMBL	tr\|M1CHQ7\|M1CHQ7_SOLTU	7E-72	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400067707}
TAIR10	AT5G22380.1	2E-46	NAC domain containing protein 90

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	25671568	25672347	+
GWHAAZE00000001	mRNA	25671568	25672347	+
GWHAAZE00000001	exon	25671568	25671733	+
GWHAAZE00000001	exon	25672013	25672347	+
GWHAAZE00000001	CDS	25671568	25671733	+
GWHAAZE00000001	CDS	25672013	25672347	+

Transcript Sequence
>GWHTAAZE001129 ATGGAGGAAATAGAAGTAGCAGGATTTAGATTCTACCCAACAGAAGAAGAGCTGGTTTCATTTTACTTGCAAAAGAAATTACAAGGAGAGGAGAGAATGGAGATGATAATGAATAGAGTTATTCCTGTGGTGCCTGTTTATGAACATGAGCCATGGGACCTTCCAAAGCTTTCAGGCGAATTATGCCACGGAGATACGGAGCAGTGGTTTTTCTTCGTGCCGAGGCAAGAGAGAGAGGCTCGGGGAGGTAGACCGAACCGGACCACCATGACCGGCTACTGGAAGGCAACAGGTTCACCTAGCTATGTTTACTCTTCTAGTAACAATAGCAAAGTTATTGGAGTGAAGAAGACAATGGTTTTTTACCAAGGCAAAGCTCCTTTAGGCACGAAAACTAAGTGGAAGATGAATGAGTATAGAGCCATTCAAGAAATTTCAATCCCTTTTGCTTCTGCTTCAATCCCTCAGGTGCACATAATTATATTCTCTGTTATGCTTTAA

Network for GWHGAAZE001127

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	7	140	1.10E-31

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.039
	SRR3591706	second leaf	3.494
	SRR3591707	mature leaf	10.124
	SRR3591708	Shoot apex	2.911
	SRR3591709	Stem	36.823
	SRR3591710	White floral bud	5.157
	SRR3591711	White flower	13.368
	SRR3591712	Green floral bud	5.523
	SRR3591713	Yellow flower	0.955
SRP173429	SRR8316895	Juvenile bud stage	29.815
	SRR8316896	Juvenile bud stage	17.088
	SRR8316897	Juvenile bud stage	32.384
	SRR8316894	Third green stage	1.759
	SRR8316900	Third green stage	1.697
	SRR8316901	Third green stage	5.207
	SRR8316898	Complete white stage	0.421
	SRR8316899	Complete white stage	13.422
	SRR8316903	Complete white stage	0.264
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.340
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.066
	SRR8316907	Gold flowering stage	0.201
	SRR8316908	Gold flowering stage	0.990
SRP132670	SRR6706286	Control	2.629
	SRR6706287	Light intensity 50%	3.274
	SRR6706288	Light intensity 20%	1.876
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.030
	CNS0095593	Slightly white alabastrum(diploid) 2	15.524
	CNS0095594	Slightly white alabastrum(diploid) 3	17.233
	CNS0095595	Whole white alabastrum(diploid) 2	9.116
	CNS0095596	Whole white alabastrum(diploid) 3	3.390
	CNS0095597	Whole white alabastrum(diploid) 4	5.916
	CNS0095598	Silvery flower (diploied) 1	41.006
	CNS0095599	Silvery flower (diploied) 2	24.799
	CNS0095600	Silvery flower (diploied) 3	5.535
	CNS0095601	Golden flower (diploid) 1	28.668
	CNS0095602	Golden flower (diploid) 2	19.236
	CNS0095603	Golden flower (diploid) 3	18.707
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.175
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.169
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.152
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.140
	CNS0095610	Silvery flower (tetraploid) 1	0.128
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.692
	CNS0095613	Golden flower (tetraploid) 1	0.155
	CNS0095614	Golden flower (tetraploid) 2	0.372
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	10.805
	CRR073298	Stem 2	6.362
	CRR073299	Stem 3	7.586
	CRR073300	Leaf 1	5.521
	CRR073301	Leaf 2	11.679
	CRR073302	Leaf 3	4.887
	CRR073303	Juvenile bud 1	2.132
	CRR073304	Juvenile bud 2	4.493
	CRR073305	Juvenile bud 3	3.248
	CRR073306	Third green 1	0.730
	CRR073307	Third green 2	0.309
	CRR073308	Third green 3	1.521
	CRR073309	Second white 1	0.499
	CRR073310	Second white 2	0.833
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.137
	CRR073315	Gold flowering 1	17.274
	CRR073316	Gold flowering 2	67.862
	CRR073317	Gold flowering 3	12.239
	CRR073318	Tawny withering 1	13.089
	CRR073319	Tawny withering 2	31.568
	CRR073320	Tawny withering 3	23.875