Gene detail

Detail information of GWHGAAZE001091

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011093669.1	2.8793E-125	PREDICTED: inositol oxygenase 2-like [Sesamum indicum]
Swissprot	tr\|Q8L799\|MIOX1_ARATH	1E-118	Inositol oxygenase 1
trEMBL	tr\|W9QX09\|W9QX09_9ROSA	9E-125	Inositol oxygenase 2 {ECO:0000313\|EMBL:EXB24695.1}
TAIR10	AT1G14520.2	2E-95	myo-inositol oxygenase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	24488283	24489972	-
GWHAAZE00000001	mRNA	24488283	24489972	-
GWHAAZE00000001	exon	24488283	24488309	-
GWHAAZE00000001	exon	24488432	24488480	-
GWHAAZE00000001	exon	24488573	24488651	-
GWHAAZE00000001	exon	24488738	24488807	-
GWHAAZE00000001	exon	24488934	24489056	-
GWHAAZE00000001	exon	24489207	24489307	-
GWHAAZE00000001	exon	24489479	24489682	-
GWHAAZE00000001	exon	24489957	24489972	-
GWHAAZE00000001	CDS	24489957	24489972	-
GWHAAZE00000001	CDS	24489479	24489682	-
GWHAAZE00000001	CDS	24489207	24489307	-
GWHAAZE00000001	CDS	24488934	24489056	-
GWHAAZE00000001	CDS	24488738	24488807	-
GWHAAZE00000001	CDS	24488573	24488651	-
GWHAAZE00000001	CDS	24488432	24488480	-
GWHAAZE00000001	CDS	24488283	24488309	-

Transcript Sequence
>GWHTAAZE001093 ATGGCAATTCATTTAGGTGAAGAGGATGAGGGAAGAGTATGGGAAGTTGGACAAAGTGGAGATAGCATTTGGGAATGTTGTGAGCTTTTGAATGAAGTGGTAGATGATAGTGATCCTGACTTGGATGAGCCTCAAATTGAGCACTTGCTGCAATCTGCAGAAGCAATTAGGAAAGACTATCCAAATGAGGATTGGTTGCACTTAACCGCACTTATTCATGATCTCGATAAAGTGCTCCTTCTTCCTAGCTTTGGAGGACTCCCTCAATGGGCTGTTGTTGGTGACACATTCCCCCTTGGATGCGCTTTCGATGAATCAATTTATTTCAAGGATAATGAGGACTACAAGAATCCAGCTTACAACACCACCAATGGTATTTACAAAGACGGATGCGGGCTAGACAATGTCGTGATGTCTTGGGGACATGATGACTACATGTATTTGGTTGCTAAGGAAAATAAAACTTCTCTACCATCAGCTGCATTATTCATCATCCGCTACCACTCTTTTTATCCTTTACTCAAATCGGGAGCATATAAACATCTGATGAATGAGGAGGATGTGGAGAATCTGAAATGGCTTAAAATATTCAACAAATATGATCTTTACAGTAAGAGCAAAGTTCGCGTTGATGTTGAAAAGTACTTTCCACCGAAGCTTAGGTGGTGA

Network for GWHGAAZE001091

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05153.16	MIOX	22	217	5.90E-94

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00469	MIOX	Metabolic pathways	map01100
		Ascorbate and aldarate metabolism	map00053
		Inositol phosphate metabolism	map00562

Gene Ontology

GO term	Ontology	Name
GO:0019310	biological_process	inositol catabolic process
GO:0055114	biological_process	oxidation-reduction process
GO:0005737	cellular_component	cytoplasm
GO:0005506	molecular_function	iron ion binding
GO:0050113	molecular_function	inositol oxygenase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.057
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.007
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.116
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.107
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.308
	CNS0095602	Golden flower (diploid) 2	0.016
	CNS0095603	Golden flower (diploid) 3	0.158
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000