Gene detail

Detail information of GWHGAAZE000989

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009372495.1	8.44572E-59	PREDICTED: superoxide dismutase [Cu-Zn], chloroplastic [Pyrus x bretschneideri]
Swissprot	tr\|O65199\|SODCP_VITVI	9E-55	Superoxide dismutase [Cu-Zn], chloroplastic (Precursor)
trEMBL	tr\|B2LYR7\|B2LYR7_GOSHI	5E-57	Superoxide dismutase [Cu-Zn] {ECO:0000256\|RuleBase:RU000393}
TAIR10	AT2G28190.1	7E-36	copper/zinc superoxide dismutase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	21222228	21225869	+
GWHAAZE00000001	mRNA	21222228	21225869	+
GWHAAZE00000001	exon	21222228	21222498	+
GWHAAZE00000001	exon	21222672	21222825	+
GWHAAZE00000001	exon	21224277	21224338	+
GWHAAZE00000001	exon	21224609	21224704	+
GWHAAZE00000001	exon	21225647	21225678	+
GWHAAZE00000001	exon	21225783	21225869	+
GWHAAZE00000001	CDS	21222228	21222498	+
GWHAAZE00000001	CDS	21222672	21222825	+
GWHAAZE00000001	CDS	21224277	21224338	+
GWHAAZE00000001	CDS	21224609	21224704	+
GWHAAZE00000001	CDS	21225647	21225678	+
GWHAAZE00000001	CDS	21225783	21225869	+

Transcript Sequence
>GWHTAAZE000991 ATGGCTGCTGCTCACACTATTCTCTCCTCCACAACCACAACTCAGCCTCACTCTCTCCTCCTCTTTTCTCTCTCTAACCGTAACCCTAATTCTTTGCCCCTCCGCACTTCCTTCCGCGGATCCTCCCTCAAAATCCCCCGCCATTCCCTAGCTCTATCTGCCGCACGCCGTGAGTCACTCACAGTCGTCGCCGCCTCCAAAAAAGCGGTCGCCGTTCTCAAGGGTAACTCCGACGTCGAAGGCATAGTTACCCTCACCCAAGAAGACGACGTACCCTCCCAAAAGGAGAACTTCAGCCCCTTCCAGTTGGCCACGGGGCAACAGCCTCTGACGCCCCACACCATTGCGACAGGAGGGGGCCCCAGGCGTCTCTCTTCTCCAAAGTCTCCTTCTTCCTGCTCTGGTTCACCTCCTGACGCTGCTTGGTCCAACTACAGTAAAAGTTCGTATCACTGGACTCACTCCGGGACCTCATGGATTTCACCTAGAGCACACTTTAACCCTAAAGGCTTGACACATGGTGCTCCTGAGGATGAAGTCCGTCATGCGGGTGACCTGGGAAACATAATTGCTAATGCCGATGGGATGGCTGAGGCAACAATTGTGGATACACAGATACCATTGACGGGGCCTAATGCGGTGATTGGGAGAGCTTTAGTGGTTCATGAGCTGGAAGATGACCTTGGAAAGGGTAAAAGTTAA

Network for GWHGAAZE000989

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00080.21	Sod_Cu	163	228	1.00E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04565	SOD1	Peroxisome	map04146
K04565	SOD1	Longevity regulating pathway - multiple species	map04213

Gene Ontology

GO term	Ontology	Name
GO:0006801	biological_process	superoxide metabolic process
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	104.702
	SRR3591706	second leaf	306.782
	SRR3591707	mature leaf	131.539
	SRR3591708	Shoot apex	210.767
	SRR3591709	Stem	61.946
	SRR3591710	White floral bud	114.985
	SRR3591711	White flower	129.634
	SRR3591712	Green floral bud	169.661
	SRR3591713	Yellow flower	123.311
SRP173429	SRR8316895	Juvenile bud stage	141.834
	SRR8316896	Juvenile bud stage	179.483
	SRR8316897	Juvenile bud stage	85.431
	SRR8316894	Third green stage	77.993
	SRR8316900	Third green stage	310.870
	SRR8316901	Third green stage	258.156
	SRR8316898	Complete white stage	101.205
	SRR8316899	Complete white stage	281.203
	SRR8316903	Complete white stage	141.683
	SRR8316902	Silver flowering stage	121.650
	SRR8316904	Silver flowering stage	136.302
	SRR8316905	Silver flowering stage	98.785
	SRR8316906	Gold flowering stage	269.908
	SRR8316907	Gold flowering stage	269.509
	SRR8316908	Gold flowering stage	196.955
SRP132670	SRR6706286	Control	261.810
	SRR6706287	Light intensity 50%	364.701
	SRR6706288	Light intensity 20%	470.671
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	145.152
	CNS0095593	Slightly white alabastrum(diploid) 2	148.410
	CNS0095594	Slightly white alabastrum(diploid) 3	106.958
	CNS0095595	Whole white alabastrum(diploid) 2	136.559
	CNS0095596	Whole white alabastrum(diploid) 3	145.712
	CNS0095597	Whole white alabastrum(diploid) 4	126.567
	CNS0095598	Silvery flower (diploied) 1	128.412
	CNS0095599	Silvery flower (diploied) 2	178.307
	CNS0095600	Silvery flower (diploied) 3	263.064
	CNS0095601	Golden flower (diploid) 1	206.774
	CNS0095602	Golden flower (diploid) 2	204.982
	CNS0095603	Golden flower (diploid) 3	199.449
	CNS0095604	Slightly white alabastrum(tetraploid) 1	204.509
	CNS0095605	Slightly white alabastrum(tetraploid) 2	171.313
	CNS0095606	Slightly white alabastrum(tetraploid) 3	289.005
	CNS0095607	Whole white alabastrum(tetraploid) 1	95.614
	CNS0095608	Whole white alabastrum(tetraploid) 2	122.756
	CNS0095609	Whole white alabastrum(tetraploid) 3	282.001
	CNS0095610	Silvery flower (tetraploid) 1	234.195
	CNS0095611	Silvery flower (tetraploid) 2	392.029
	CNS0095612	Silvery flower (tetraploid) 3	381.275
	CNS0095613	Golden flower (tetraploid) 1	150.481
	CNS0095614	Golden flower (tetraploid) 2	195.016
	CNS0095615	Golden flower (tetraploid) 3	221.963
CRA001975	CRR073297	Stem 1	301.912
	CRR073298	Stem 2	291.492
	CRR073299	Stem 3	389.826
	CRR073300	Leaf 1	349.128
	CRR073301	Leaf 2	349.700
	CRR073302	Leaf 3	401.252
	CRR073303	Juvenile bud 1	439.218
	CRR073304	Juvenile bud 2	492.110
	CRR073305	Juvenile bud 3	351.121
	CRR073306	Third green 1	530.398
	CRR073307	Third green 2	379.834
	CRR073308	Third green 3	334.221
	CRR073309	Second white 1	504.089
	CRR073310	Second white 2	375.389
	CRR073311	Second white 3	292.442
	CRR073312	Silver flowering 1	309.178
	CRR073313	Silver flowering 2	322.434
	CRR073314	Silver flowering 3	264.381
	CRR073315	Gold flowering 1	339.704
	CRR073316	Gold flowering 2	412.528
	CRR073317	Gold flowering 3	512.954
	CRR073318	Tawny withering 1	181.290
	CRR073319	Tawny withering 2	141.687
	CRR073320	Tawny withering 3	199.482