Gene detail

Detail information of GWHGAAZE000959

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDX89923.1	4.42483E-60	BnaA10g01590D [Brassica napus]
Swissprot	tr\|Q8RY16\|PEX6_ARATH	9E-62	Peroxisome biogenesis protein 6
trEMBL	tr\|M1A372\|M1A372_SOLTU	3E-62	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400013680}
TAIR10	AT1G03000.1	1E-53	peroxin 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	20475573	20476176	-
GWHAAZE00000001	mRNA	20475573	20476176	-
GWHAAZE00000001	exon	20475573	20475671	-
GWHAAZE00000001	exon	20475809	20475931	-
GWHAAZE00000001	exon	20476057	20476176	-
GWHAAZE00000001	CDS	20476057	20476176	-
GWHAAZE00000001	CDS	20475809	20475931	-
GWHAAZE00000001	CDS	20475573	20475671	-

Transcript Sequence
>GWHTAAZE000961 ATGATTTCTGATTCTTGTTCATTGTATCTGCAGCTGCCTCTCATGCATAAGGATTTGTTTTCCTCTGGGTTGCGCAAGCGCTCTGGTGTTCTTTTATATGGTCCTCTTGGGACAGGGAAAACTCTGTTAGCAAAAGCTGCTGCAATAGAGTGCTCCCTTAACTTTCTCAGTGTTAAAGGGCCTGAATTGATCAACATGTACATTGGAGAATCGGAAAAAAATGTGCGAGACATTTTTCATAAGGCCAGATCAGCACGTCCGTGTGTCATTTTCTTTGATGAGCTTGATTCTCTTGCTCCTGCCAGGGGTGCTTCTGGAGATTCTGGGGGTGTTATGGATTGA

Network for GWHGAAZE000959

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00004.30	AAA	30	106	4.00E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13339	PEX6, PXAAA1	Peroxisome	map04146

Gene Ontology

GO term	Ontology	Name
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.325
	SRR3591707	mature leaf	0.546
	SRR3591708	Shoot apex	0.357
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.245
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.159
	SRR3591713	Yellow flower	0.549
SRP173429	SRR8316895	Juvenile bud stage	4.658
	SRR8316896	Juvenile bud stage	2.736
	SRR8316897	Juvenile bud stage	1.583
	SRR8316894	Third green stage	0.610
	SRR8316900	Third green stage	0.312
	SRR8316901	Third green stage	0.802
	SRR8316898	Complete white stage	0.395
	SRR8316899	Complete white stage	1.811
	SRR8316903	Complete white stage	0.043
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.076
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.437
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.195
	SRR6706287	Light intensity 50%	1.678
	SRR6706288	Light intensity 20%	1.437
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.629
	CNS0095593	Slightly white alabastrum(diploid) 2	0.230
	CNS0095594	Slightly white alabastrum(diploid) 3	0.743
	CNS0095595	Whole white alabastrum(diploid) 2	0.628
	CNS0095596	Whole white alabastrum(diploid) 3	0.753
	CNS0095597	Whole white alabastrum(diploid) 4	0.271
	CNS0095598	Silvery flower (diploied) 1	0.703
	CNS0095599	Silvery flower (diploied) 2	2.160
	CNS0095600	Silvery flower (diploied) 3	0.096
	CNS0095601	Golden flower (diploid) 1	1.085
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.601
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.024
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.932
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.309
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.223
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.138
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.393
	CNS0095610	Silvery flower (tetraploid) 1	0.157
	CNS0095611	Silvery flower (tetraploid) 2	0.225
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.041
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.195
CRA001975	CRR073297	Stem 1	16.652
	CRR073298	Stem 2	7.623
	CRR073299	Stem 3	4.202
	CRR073300	Leaf 1	2.139
	CRR073301	Leaf 2	2.897
	CRR073302	Leaf 3	0.556
	CRR073303	Juvenile bud 1	0.352
	CRR073304	Juvenile bud 2	0.039
	CRR073305	Juvenile bud 3	0.118
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.032
	CRR073310	Second white 2	0.027
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.061
	CRR073313	Silver flowering 2	0.298
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.599
	CRR073317	Gold flowering 3	0.045
	CRR073318	Tawny withering 1	3.481
	CRR073319	Tawny withering 2	3.745
	CRR073320	Tawny withering 3	2.863